SubtiWiki SubtiWiki
ykuJ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykuJ
168

unknown

locus
BSU_14100
Molecular weight
9.11 kDa
pI
4.34
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykuJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4703

This gene is a member of the following regulons

Gene
Coordinates
1,484,117  1,484,356
The protein
Structure
[PDB|2FFG]
Expression and Regulation
Operons
genes
[gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]-[gene|7FD784C885605F7FD27898BC9E83C28F21BE0E9D|ykuK]-[gene|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA]-[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]-[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]
description
[Pubmed|16395550]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, by [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]~P [Pubmed|18840696,14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|16395550,12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]→[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]

2021-09-18 05:52:34

ghost

6

c31a71bd4220fdbe189c19124eb835899db4473b

DE202F49BDBFA88FBD49A4685EB1CB8595CFCE08

Biological materials
Mutant
MGNA-A771 (ykuJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/771 NBRP B. subtilis, Japan]
GP214 (deletion of ''[gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]-[gene|7FD784C885605F7FD27898BC9E83C28F21BE0E9D|ykuK]-[gene|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA]-[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]'', replaced by ''aphA3''), available in [wiki|Jörg Stülke]'s lab
BKE14100 ([gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAAAAAGACTCCT,  downstream forward: _UP4_TAAGATTCCTGAAATAGGGG
BKK14100 ([gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAAAAAGACTCCT,  downstream forward: _UP4_TAAGATTCCTGAAATAGGGG
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP710 (in [wiki|pAC5]), available in [wiki|Jörg Stülke]'s lab, pGP714 (in [wiki|pAC6]), available in [wiki|Jörg Stülke]'s lab
References
16395550

A26502ADAC214D45A8F7F394587B0BDFBE7AF28E

Page visits: 1203

Time of last update: 2021-09-08 12:40:19

Author of last update: Rica