SubtiWiki SubtiWiki
yqjZ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqjZ
168

unknown

locus
BSU_23680
Molecular weight
12.91 kDa
pI
5.16
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yqjZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2329

This gene is a member of the following regulons

Gene
Coordinates
2,463,217  2,463,561
The protein
[wiki|Domains]
[wiki|ABM domain] (aa 13-99) (according to UniProt)
Structure
[PDB|2GO8]
Expression and Regulation
Operons
genes
[gene|5B8A6D282E34683726BD6C36E09A6C36E8F99795|yqjY]-[gene|9F88AC3A792F4EE8AA853849BBCF5065717B1D8B|yqjZ]-[gene|3ECD25A4ED9556E74112285B11FC180A7091D730|yqkA]-[gene|DC1C1D4BE1A7F4E28792A2B8273AFE2C7F90E58C|yqkB]-[gene|30363923724EBD39C27967B25B486C71453190D1|yqkC]
description
[Pubmed|22383849]
Open in new tab

[gene|5B8A6D282E34683726BD6C36E09A6C36E8F99795|yqjY]→[gene|30363923724EBD39C27967B25B486C71453190D1|yqkC]

2021-07-13 01:23:48

Jstuelk

2

830bea892b35ccfe2edb93f51a0d97337c89c649

427C27B55BA8B340929A1E1871212518502EC01F

genes
[gene|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|polY2]-[gene|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|yqjX]-[gene|5B8A6D282E34683726BD6C36E09A6C36E8F99795|yqjY]-[gene|9F88AC3A792F4EE8AA853849BBCF5065717B1D8B|yqjZ]-[gene|3ECD25A4ED9556E74112285B11FC180A7091D730|yqkA]-[gene|DC1C1D4BE1A7F4E28792A2B8273AFE2C7F90E58C|yqkB]-[gene|30363923724EBD39C27967B25B486C71453190D1|yqkC]
description
[Pubmed|22383849]
regulation
induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]) [Pubmed|15469515,16267290]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|15469515,16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
Open in new tab

[gene|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|polY2]→[gene|30363923724EBD39C27967B25B486C71453190D1|yqkC]

2021-07-21 00:02:13

Jstuelk

8

6c329771c98f2f94cc2c706dd8b0c4756b3f5ff2

F1EDE678EE7D5F06E30BC961BB2724AF40F4644A

Biological materials
Mutant
MGNA-C406 (yqjZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2404 NBRP B. subtilis, Japan]
BKE23680 ([gene|9F88AC3A792F4EE8AA853849BBCF5065717B1D8B|yqjZ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCCCTCATATGT,  downstream forward: _UP4_ACGAATGATTGAATTTCTCC
BKK23680 ([gene|9F88AC3A792F4EE8AA853849BBCF5065717B1D8B|yqjZ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCCCCTCATATGT,  downstream forward: _UP4_ACGAATGATTGAATTTCTCC

9F88AC3A792F4EE8AA853849BBCF5065717B1D8B

Page visits: 624

Time of last update: 2021-09-01 15:43:46

Author of last update: Melvin.boenninger