SubtiWiki SubtiWiki
cgeD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cgeD
168

maturation of the outermost layer of the spore

locus
BSU_19760
Molecular weight
49.91 kDa
pI
7.19
Protein length
Gene length
function
maturation of the outermost layer of the spore
product
unknown
essential
no
synonyms
cgeD, cgeBB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0463

This gene is a member of the following regulons

Gene
Coordinates
2,146,821  2,148,101
The protein
Structure
[PDB|1QG8] (the N-terminal domain, [protein|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA], 46% identity) [pubmed|10350455]
Paralogous protein(s)
[protein|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA], Array
Expression and Regulation
Operons
genes
[gene|6C7778EFFADDF522E2DBC32219D83E7CBCF2BED0|cgeC]-[gene|9EDE093896E8535962903D7A202D69C1BC402C09|cgeD]-[gene|11966AE70567D707D546C4A2F12B2DEAE95A1883|cgeE]
description
[Pubmed|7592393]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|7592393]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|7592393], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|7592393,15699190], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|26577401], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|6C7778EFFADDF522E2DBC32219D83E7CBCF2BED0|cgeC]→[gene|11966AE70567D707D546C4A2F12B2DEAE95A1883|cgeE]

2021-08-22 04:49:35

ghost

5

e170cafa7156b825317e719d055b273d6326b7fb

926AFF900EBB7AF0544861197FC1F32E7A70F282

Biological materials
Mutant
BKE19760 ([gene|9EDE093896E8535962903D7A202D69C1BC402C09|cgeD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATACCGCCTCCCGCC,  downstream forward: _UP4_TAAAGGTATAGGTCATAAAA
BKK19760 ([gene|9EDE093896E8535962903D7A202D69C1BC402C09|cgeD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATACCGCCTCCCGCC,  downstream forward: _UP4_TAAAGGTATAGGTCATAAAA
References
7592393,15699190,26577401,10350455

9EDE093896E8535962903D7A202D69C1BC402C09

Page visits: 1608

Time of last update: 2021-09-17 12:51:36

Author of last update: Jstuelk