SubtiWiki SubtiWiki
purD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

purD
168

phosphoribosylglycinamide synthetase

locus
BSU_06530
Molecular weight
45.12 kDa
pI
4.6
Protein length
Gene length
function
purine biosynthesis
product
phosphoribosylglycinamide synthetase
essential
no
ec
6.3.4.13
synonyms
purD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0151

This gene is a member of the following regulons

Gene
Coordinates
710,148 711,416
The protein
Catalyzed reaction/ biological activity
5-phospho-D-ribosylamine + ATP + glycine --> ADP + H+ + N1-(5-phospho-D-ribosyl)glycinamide + phosphate (according to UniProt)
Protein family
GARS family (single member, according to UniProt)
[wiki|Domains]
[wiki|ATP-grasp doamin] (aa 107-313) (according to UniProt)
Structure
[PDB|2XCL]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
description
[Pubmed|3036807]
regulation
expression activated by glucose (4.4 fold) [Pubmed|12850135]
regulatory mechanism
G-box: termination, ([wiki|riboswitch]) [pubmed|3036807,12787499], in [regulon|other_regulator:G-box|G-box]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3036807], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]→[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]

2021-11-01 01:00:21

Jstuelk

14

ace69dc80f4f087486c218727fa370a7a9630d21

EDD8EC37B0E5B38941D5827C265AB2F23CF23EA7

Biological materials
Mutant
BKE06530 ([gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTCACGTCGTTTTCAT, downstream forward: _UP4_TAAGTGAGGAAAACCCGCAG
BKK06530 ([gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTCACGTCGTTTTCAT, downstream forward: _UP4_TAAGTGAGGAAAACCCGCAG
References
3036807,12923093,15378759,7638212

9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E

Page visits: 2867

Time of last update: 2021-12-04 09:38:37

Author of last update: Melvin.boenninger