SubtiWiki SubtiWiki
purD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

purD
168

phosphoribosylglycinamide synthetase

locus
BSU_06530
Molecular weight
45.12 kDa
pI
4.6
Protein length
Gene length
function
purine biosynthesis
product
phosphoribosylglycinamide synthetase
essential
no
ec
6.3.4.13
synonyms
purD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0151

This gene is a member of the following regulons

Gene
Coordinates
710,148 711,416
The protein
Catalyzed reaction/ biological activity
5-phospho-D-ribosylamine + ATP + glycine --> ADP + H+ + N1-(5-phospho-D-ribosyl)glycinamide + phosphate (according to UniProt)
Protein family
GARS family (single member, according to UniProt)
[wiki|Domains]
[wiki|ATP-grasp doamin] (aa 107-313) (according to UniProt)
Structure
[PDB|2XCL]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
description
[Pubmed|3036807]
regulation
expression activated by glucose (4.4 fold) [Pubmed|12850135]
regulatory mechanism
G-box: termination, ([wiki|riboswitch]) [pubmed|3036807,12787499], in [regulon|other_regulator:G-box|G-box]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3036807], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]→[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]

2021-09-15 10:29:43

Jstuelk

12

ace69dc80f4f087486c218727fa370a7a9630d21

EDD8EC37B0E5B38941D5827C265AB2F23CF23EA7

Biological materials
Mutant
BKE06530 ([gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTCACGTCGTTTTCAT, downstream forward: _UP4_TAAGTGAGGAAAACCCGCAG
BKK06530 ([gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTCACGTCGTTTTCAT, downstream forward: _UP4_TAAGTGAGGAAAACCCGCAG
References
3036807,12923093,15378759,7638212

9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E

Page visits: 2792

Time of last update: 2021-09-15 10:29:19

Author of last update: Melvin.boenninger