SubtiWiki SubtiWiki
sipU
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sipU
168

signal peptidase I

locus
BSU_04010
Molecular weight
21.04 kDa
pI
9.84
Protein length
Gene length
function
protein secretion
product
signal peptidase I
essential
no
synonyms
sipU, ycsB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0681

This gene is a member of the following regulons

Gene
Coordinates
454,029  454,592
The protein
Catalyzed reaction/ biological activity
Cleavage of hydrophobic, N-terminal signal or leader sequences from secreted and periplasmic proteins (according to UniProt)
Protein family
[wiki|peptidase S26 family] (according to UniProt)
Structure
[PDB|4NV4] (from B. anthracis, 41% identity)
Paralogous protein(s)
[protein|ADEEA5E15C100C1DC6E129B9A3E6DECAFCA8C409|sipV], [protein|C2EAE417DB9250B88BB0E25D4AE760BDE82EFD86|sipT], [protein|CDC6971F39F3EEAAE912CB1402EE1BD64D5A12A0|sipS]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]
description
[pubmed|22383849]
Open in new tab

[gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]

2021-09-19 07:24:03

Jstuelk

3

028b3bdaa67f29f2bc0f7bff294e1385944f46a4

8E1C2C585AF93143469E091BFD2FE03A2EDBC41A

Biological materials
Mutant
BKE04010 ([gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTTCCTTCACCCGATGC,  downstream forward: _UP4_TAAAATGCAATGCAAAAAGA
BKK04010 ([gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTTCCTTCACCCGATGC,  downstream forward: _UP4_TAAAATGCAATGCAAAAAGA
labs
[wiki|Jan Maarten van Dijl], Groningen, Netherlands
References
Reviews
22688815,34410368
Original Publications
9325333,9694797,28088521

9824F9CF9C2028AF267AC43FE7FD8590E8231AB8

Page visits: 1812

Time of last update: 2021-09-18 19:14:48

Author of last update: Jstuelk