SubtiWiki SubtiWiki
yebE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yebE
168

unknown

locus
BSU_06400
Molecular weight
20.52 kDa
pI
9.62
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yebE, yebF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4843

This gene is a member of the following regulons

Gene
Coordinates
697,538  698,092
The protein
Protein family
UPF0316 family (single member, according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|976E12C93EB813D05EB3B46DE8579B98687F83DA|yebE]-[gene|B7348FDC2690B0A7E17A7ED10FB7CC5C55E15707|yebG]
description
[pubmed|22383849]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|976E12C93EB813D05EB3B46DE8579B98687F83DA|yebE]->[gene|B7348FDC2690B0A7E17A7ED10FB7CC5C55E15707|yebG]

2021-09-18 05:58:08

Bzhu

5

1a56e9bd3297fe55f96af95dedd562665880725c

0B7C6C61957430C0B9B5BDD0AD0501F2AC17A463

Biological materials
Mutant
BKE06400 ([gene|976E12C93EB813D05EB3B46DE8579B98687F83DA|yebE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTATTCATCCCCCTAC,  downstream forward: _UP4_AAGAAGAGGAGAATTAAAGA
BKK06400 ([gene|976E12C93EB813D05EB3B46DE8579B98687F83DA|yebE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTATTCATCCCCCTAC,  downstream forward: _UP4_AAGAAGAGGAGAATTAAAGA
References
26577401

976E12C93EB813D05EB3B46DE8579B98687F83DA

Page visits: 1436

Time of last update: 2021-09-18 05:58:04

Author of last update: Melvin.boenninger