SubtiWiki SubtiWiki
aprX
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

aprX
168

intracellular alkaline serine protease

locus
BSU_17260
Molecular weight
47.74 kDa
pI
4.97
Protein length
Gene length
function
protein degradation
product
intracellular alkaline serine protease
essential
no
synonyms
aprX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1404

This gene is a member of the following regulons

Gene
Coordinates
1,861,384  1,862,712
The protein
Protein family
[wiki|peptidase S8 family] (according to UniProt)
[wiki|Domains]
[wiki|Peptidase S8 domain] (aa 122-439) (according to UniProt)
Structure
[PDB|3WHI] ([protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|aprE], corresponds to aa 78 ... 436, 33% identity) [pubmed|24279884]
Expression and Regulation
Operons
genes
[gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]
description
[Pubmed|22383849]
regulation
induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]) [Pubmed|16267290]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10589719], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]

2021-05-26 18:25:03

Jstuelk

5

31d056fdbc6d6278981e708ff8be8d60f025b0fb

C80B550023CBA5C0D32374396F9A0E306850B8E0

Biological materials
Mutant
MGNA-A019 (aprX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/19 NBRP B. subtilis, Japan]
BKE17260 ([gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATTTTCCTCCTATTA,  downstream forward: _UP4_TAAACATCATCAAAAGCCGG
BKK17260 ([gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTATTTTCCTCCTATTA,  downstream forward: _UP4_TAAACATCATCAAAAGCCGG
References
Reviews
34410368
Original Publications
10589719,16267290,24279884
Labs working on this gene/protein
[wiki|Alessandra Albertini], University of Pavia, Italy [http://www-1.unipv.it/genbiom/albertini.html homepage]

945A1332A020CF842DA590589C88C758DE65C84E

Page visits: 1667

Time of last update: 2021-09-17 13:55:31

Author of last update: Jstuelk