SubtiWiki SubtiWiki
yshB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yshB
168

unknown

locus
BSU_28600
Molecular weight
19.39 kDa
pI
8.53
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yshB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1286

This gene is a member of the following regulons

Gene
Coordinates
2,925,100  2,925,633
Expression and Regulation
Operons
genes
[gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]-[gene|93726C423313C653C4F71CB107FA12F686959E41|yshB]-[gene|D3954F2BCF6CE66505E4F48FCB4A61EE8D24F6D3|polX]-[gene|F8E82D9AE514B31892FE4530532691274ADA682B|mutSB]-[gene|18CEF3F1EE2E95A009699DE370CBB44F025B7B40|yshE]
description
[Pubmed|22383849]
regulation
constitutively expressed [Pubmed|23701187]
Open in new tab

[gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]→[gene|18CEF3F1EE2E95A009699DE370CBB44F025B7B40|yshE]

2021-08-27 00:22:14

Jstuelk

10

a60f402276d016cd1954cecdf421cd68dd4fd667

C40CD769E454F6213CFF839AD02CA2F4B6A46C6B

Biological materials
Mutant
MGNA-A988 (yshB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/988 NBRP B. subtilis, Japan]
BKE28600 ([gene|93726C423313C653C4F71CB107FA12F686959E41|yshB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATGATGATATCTAGCATAG,  downstream forward: _UP4_TAAAAAAACTTCTCTTGTCC
BKK28600 ([gene|93726C423313C653C4F71CB107FA12F686959E41|yshB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATGATGATATCTAGCATAG,  downstream forward: _UP4_TAAAAAAACTTCTCTTGTCC
References
12368265,8969504

93726C423313C653C4F71CB107FA12F686959E41

Page visits: 964

Time of last update: 2021-08-07 10:15:17

Author of last update: Bzhu