SubtiWiki SubtiWiki
fosB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fosB
168

bacillithiol-S-transferase; confers resistence against antimicrobial compounds from B. amyloliquefaciens

locus
BSU_17840
Molecular weight
17.03 kDa
pI
6.14
Protein length
Gene length
function
confers resistence against antimicrobial compounds from B. amyloliquefaciens
product
fosfomycin resistance protein
essential
no
synonyms
fosB, yndN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0346

This gene is a member of the following regulons

Gene
Coordinates
1,916,663  1,917,097
Phenotypes of a mutant
sensitive to fosfomycin [pubmed|11244082]
The protein
Protein family
fosfomycin resistance protein family (single member, according to UniProt)
[wiki|Domains]
[wiki|VOC domain] (aa 5-120) (according to UniProt)
[wiki|Cofactors]
Mg2+ [pubmed|11244082]
Structure
[PDB|4JD1] (from B. anthracis, 66% identity)
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]
description
[Pubmed|11244082]
regulation
expressed under stress conditions ([protein|search|SigW]) [Pubmed|11244082]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11244082], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|fosB]' and '[protein|search|lexA]' [PubMed|20525796]
Open in new tab

[gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]

2021-07-12 00:57:39

ghost

1

2b973ec1127729d9437d7fcdd76e683b0527e57d

3C87BDB08AFCCBE32D44129BF78488366D678475

Biological materials
Mutant
MGNA-B387 (yndN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1386 NBRP B. subtilis, Japan]
BKE17840 ([gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCCTTG,  downstream forward: _UP4_TGATAGCACAACCATATTTC
BKK17840 ([gene|92E4F908B7CDE64743796CCD3188FE6BB5288365|fosB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAAATCATTCCCCCCTTG,  downstream forward: _UP4_TGATAGCACAACCATATTTC
References
11244082,16629676,20525796,23030527,23256780

92E4F908B7CDE64743796CCD3188FE6BB5288365

Page visits: 1374

Time of last update: 2021-09-18 20:58:11

Author of last update: Melvin.boenninger