SubtiWiki SubtiWiki
ylnD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylnD
168

probable uroporphyrin-III C-methyltransferase

locus
BSU_15610
Molecular weight
28.37 kDa
pI
5.75
Protein length
Gene length
function
siroheme biosynthesis , sulfite reduction
product
probable uroporphyrin-III C-methyltransferase
essential
no
ec
2.1.1.107
synonyms
ylnD, sumT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0007

This gene is a member of the following regulons

Gene
Coordinates
1,634,061  1,634,834
The protein
Catalyzed reaction/ biological activity
2 S-adenosyl-L-methionine + uroporphyrinogen III --> H+ + precorrin-2 + 2 S-adenosyl-L-homocysteine (according to UniProt)
Protein family
precorrin methyltransferase family (with [protein|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF], according to UniProt)
Structure
[PDB|1PJQ] (CysG from ''Salmonella enterica'', 46% identity) [Pubmed|14595395]
Paralogous protein(s)
[protein|159A6D0D45B5F0F055228357FD9A3BF8E5A999E5|nasF], (corresponds to N-terminal domain of NasF)
Expression and Regulation
Operons
genes
[gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
description
[Pubmed|11004190]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: repression, in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
S-box: termination, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11004190], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]→[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]

2021-06-26 08:13:24

Jstuelk

5

ee26ed9bec04d4ffdc2deea174a197c7290dfe30

AC610BA23AE4EE98F22EC54E46509E3060BAE285

Biological materials
Mutant
MGNA-B368 (ylnD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1367 NBRP B. subtilis, Japan]
BKE15610 ([gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTATTTCCCCCGATCT,  downstream forward: _UP4_GATTTAAGCGAGGCGTTGTA
BKK15610 ([gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTATTTCCCCCGATCT,  downstream forward: _UP4_GATTTAAGCGAGGCGTTGTA
References
10217486,16267287,11004190,12107147,18039762,14595395

92831D5A8E07A18BA6C6978123769D00D685BB45

Page visits: 1285

Time of last update: 2021-08-30 11:44:04

Author of last update: Melvin.boenninger