SubtiWiki SubtiWiki
yvyE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvyE
168

unknown

locus
BSU_35510
Molecular weight
24.69 kDa
pI
5.8
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yvyE, yvhK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1739

This gene is a member of the following regulons

Gene
Coordinates
3,646,753  3,647,406
The protein
Protein family
IMPACT family (single member, according to UniProt)
Structure
[PDB|2CVE] (from Thermus thermophilus, 35% identity)
Expression and Regulation
Operons
genes
[gene|8F46DEAD6195B566E1A5FDC6E6ED9D29969F4AFA|yvyE]-[gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]
description
[Pubmed|22383849]
regulation
repressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
Open in new tab

[gene|8F46DEAD6195B566E1A5FDC6E6ED9D29969F4AFA|yvyE]→[gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]

2021-07-11 17:30:56

ghost

4

434d5c1034a945aaa3ecc1561c073981d68a60ce

06E62DFCE6F5AF65909104B2BE1D0FEF606B7CDC

Biological materials
Mutant
MGNA-A348 (yvyE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/348 NBRP B. subtilis, Japan]
BKE35510 ([gene|8F46DEAD6195B566E1A5FDC6E6ED9D29969F4AFA|yvyE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTAGCTGACCCTCCTG,  downstream forward: _UP4_AATCACATAAAGGAGACTGA
BKK35510 ([gene|8F46DEAD6195B566E1A5FDC6E6ED9D29969F4AFA|yvyE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTAGCTGACCCTCCTG,  downstream forward: _UP4_AATCACATAAAGGAGACTGA
References
14651647,22383849

8F46DEAD6195B566E1A5FDC6E6ED9D29969F4AFA

Page visits: 900

Time of last update: 2021-09-13 12:58:31

Author of last update: Melvin.boenninger