SubtiWiki SubtiWiki
spoIIIL
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIIIL
168

component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|spoIIQ] trans-envelope complex, required for the activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]

locus
BSU_24660
Molecular weight
9.62 kDa
pI
10.58
Protein length
Gene length
function
activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]
product
component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|spoIIQ] trans-envelope complex
essential
no
synonyms
spoIIIL, yqzE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5873

This gene is a member of the following regulons

Gene
Coordinates
2,555,887  2,556,066
Phenotypes of a mutant
reduced [wiki|sporulation] efficiency (14% compared to wild type) [Pubmed|26735940]
the ''[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL] [gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]'' double mutant has a severe [wiki|sporulation] defect (0.001%) [Pubmed|26735940]
The protein
[wiki|Localization]
forespore [Pubmed|26735940]
Expression and Regulation
Operons
genes
[gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG]-[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]
description
[Pubmed|26735940,2507524]
regulation
expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
regulatory mechanism
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, [Pubmed|8196543], in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2507524], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|26735940], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
additional information
the ''[wiki|comGA]-[wiki|comGB]-[wiki|comGC]-[wiki|comGD]-[wiki|comGE]-[wiki|comGF]-[wiki|comGG]-[protein|search|spoIIIL]'' operon requires [wiki|NusA] for expression [http://www.nature.com/articles/nmicrobiol20157 Reference]
Open in new tab

[gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]→[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]

2021-07-24 23:46:34

ghost

9

68b5c7c810efc0f97977f58e74fdbac224ab84c2

180BC451CD3457041F2E10E00872F9C6ECB091B7

genes
[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]
description
[Pubmed|26735940]
regulation
expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
additional information
the ''[wiki|comGA]-[wiki|comGB]-[wiki|comGC]-[wiki|comGD]-[wiki|comGE]-[wiki|comGF]-[wiki|comGG]-[protein|search|spoIIIL]'' operon requires [wiki|NusA] for expression [http://www.nature.com/articles/nmicrobiol20157 Reference]
Open in new tab

[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]

2021-08-31 05:55:50

ghost

2

b3e6004126804c432b73811018f2086fbabcf7cf

92AE6B2B0FAFE1DBE27AD62D648183C7EDA61BBE

Biological materials
Mutant
MGNA-C472 (yqzE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2470 NBRP B. subtilis, Japan]
BKE24660 ([gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTGATCACCTCATCATT,  downstream forward: _UP4_TAACCGCAAATAAACGAATA
BKK24660 ([gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTGATCACCTCATCATT,  downstream forward: _UP4_TAACCGCAAATAAACGAATA
References
Reviews
31350897
Original Publications
2507524,23033921,12107147,8196543,26735940

8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B

Page visits: 1236

Time of last update: 2021-09-02 16:09:55

Author of last update: Jstuelk