SubtiWiki SubtiWiki
tdh
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tdh
168

L-threonine dehydrogenase

locus
BSU_16990
Molecular weight
36.84 kDa
pI
6.06
Protein length
Gene length
function
threonine utilization
product
L-threonine dehydrogenase
essential
no
ec
1.1.1.103
synonyms
tdh

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1063

This gene is a member of the following regulons

Gene
Coordinates
1,770,461  1,771,504
The protein
Catalyzed reaction/ biological activity
L-threonine + NAD+ --> (2S)-2-amino-3-oxobutanoate + H+ + NADH (according to UniProt)
Protein family
[wiki|zinc-containing alcohol dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
NAD+ (according to UniProt)
Structure
[PDB|2DQ4] (from ''Thermus thermophilus'', 47% identity, 63% similarity)
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]-[gene|1BC05699DEB3A16944FB8305F22976AED75805E8|kbl]
description
[Pubmed|22383849]
Open in new tab

[gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]→[gene|1BC05699DEB3A16944FB8305F22976AED75805E8|kbl]

2021-08-13 05:56:44

Jstuelk

3

fab32661cd3503f53c153d1ea771a2cee697e21c

5A29EEF0FA10A4FBE2CF780104BE349FE0DA8B77

Biological materials
Mutant
BKE16990 ([gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTACAATCCTCCTTGAA,  downstream forward: _UP4_TTAATTCCATAAAGGGGGAT
BKK16990 ([gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTACAATCCTCCTTGAA,  downstream forward: _UP4_TTAATTCCATAAAGGGGGAT
References
Research papers
31585995

8E64B62F15B92A2AACD68B913909100AE276D114

Page visits: 1013

Time of last update: 2021-07-30 19:33:56

Author of last update: Jstuelk