SubtiWiki SubtiWiki
tdh

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

tdh
168

L-threonine dehydrogenase

locus
BSU_16990
Molecular weight
36.84 kDa
pI
6.06
Protein length
Gene length
function
threonine utilization
product
L-threonine dehydrogenase
essential
no
ec
1.1.1.103
synonyms
tdh

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1063

This gene is a member of the following regulons

Gene
Coordinates
1,770,461  1,771,504
The protein
Catalyzed reaction/ biological activity
L-threonine + NAD+ --> (2S)-2-amino-3-oxobutanoate + H+ + NADH (according to UniProt)
Protein family
[wiki|zinc-containing alcohol dehydrogenase family] (according to UniProt)
[wiki|Cofactors]
NAD+ (according to UniProt)
Structure
[PDB|2DQ4] (from ''Thermus thermophilus'', 47% identity, 63% similarity)
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]-[gene|1BC05699DEB3A16944FB8305F22976AED75805E8|kbl]
description
[Pubmed|22383849]
Open in new tab

[gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]→[gene|1BC05699DEB3A16944FB8305F22976AED75805E8|kbl]

2021-10-30 09:44:13

Jstuelk

6

fab32661cd3503f53c153d1ea771a2cee697e21c

5A29EEF0FA10A4FBE2CF780104BE349FE0DA8B77

Biological materials
Mutant
BKE16990 ([gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTACAATCCTCCTTGAA,  downstream forward: _UP4_TTAATTCCATAAAGGGGGAT
BKK16990 ([gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTACAATCCTCCTTGAA,  downstream forward: _UP4_TTAATTCCATAAAGGGGGAT
References
Research papers
31585995

8E64B62F15B92A2AACD68B913909100AE276D114

Page visits: 1022

Time of last update: 2021-11-19 12:18:48

Author of last update: Jstuelk