SubtiWiki SubtiWiki
bceA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bceA
168

primary bacitracin resistance determinant, [wiki|ABC transporter] (ATP-binding protein), protects cell wall biosynthetic targets from inhibition by antimicrobial peptides

locus
BSU_30380
Molecular weight
28.08 kDa
pI
9.29
Protein length
Gene length
function
protection of cell wall biosynthetic targets from inhibition by antimicrobial peptides
product
[wiki|ABC transporter] (ATP-binding protein) for target protection of cell wall synthesis
essential
no
synonyms
bceA, ytsC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1136

This gene is a member of the following regulons

Gene
Coordinates
3,111,327  3,112,088
Phenotypes of a mutant
85-fold increased sensitivity to bacitracin [Pubmed|26815905]
The protein
Catalyzed reaction/ biological activity
releaves intermediates of the lipid II cycle from the inhibitory interaction with antimicrobial peptides such as bacitracin [pubmed|31871088]
Protein family
[wiki|ABC transporter] family (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 4-243) (according to UniProt)
Structure
[PDB|1L2T] (MJ0796 from '' Methanocaldococcus jannaschii '', 38% identity) [Pubmed|12150914]
Effectors of protein activity
the activity of the [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]-[protein|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB] [wiki|ABC transporter] is inhibited by heptaprenyl pyrophosphate which accumulates in a ''[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]'' mutant [Pubmed|24806199]
Paralogous protein(s)
[protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY], [protein|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE], [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL], [protein|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA], [protein|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]
[wiki|Localization]
membrane associated (via [protein|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB]) [Pubmed|12890034]
Expression and Regulation
Operons
genes
[gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]-[gene|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB]
description
[Pubmed|12890034]
regulation
induced in the presence of bacitracin, plectasin, mersacidin and actagardine, already at very low levels of bacitracin ([protein|search|BceR]) [Pubmed|12890034,26815905]
regulatory mechanism
[protein|C239C155F5452C86BF6C78190BABBBB07A63DF87|bceR]: activation, [Pubmed|12890034], in [regulon|protein:C239C155F5452C86BF6C78190BABBBB07A63DF87|bceR regulon]
Open in new tab

[gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]→[gene|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB]

2021-09-03 03:06:10

ghost

5

82aefb4fbb9fc68f93e518da69b01bd8ff729fe6

34D10F148A3DBFC0AFB70F7B58E13B120EF4A646

Biological materials
Mutant
GP3218 Δ([gene|C239C155F5452C86BF6C78190BABBBB07A63DF87|bceR]-[gene|08F24CA21DC54031F6158AC0C772F3B520E5A849|bceS]-[gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]-[gene|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB])::''cat'', available in [wiki|Jörg Stülke]'s lab
MGNA-A167 (ytsC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/167 NBRP B. subtilis, Japan]
BKE30380 ([gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTACGCAGTCTCCTTTA,  downstream forward: _UP4_CAAGGCGTGTTAGGCGGGGT
BKK30380 ([gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTACGCAGTCTCCTTTA,  downstream forward: _UP4_CAAGGCGTGTTAGGCGGGGT
labs
[wiki|Susanne Gebhard], Bath UK
References
Reviews
27344142,28152228,29404338,33450852
Original Publications
17905982,18394148,12890034,14651641,10092453,14612242,21283517,20606066,21078927,23687272,24806199,25118291,26199330,26364265,12150914,27997719,26815905,31871088,32019833,32955745

8E0DE8FE7E9C12495C4DCADA74D838FED088867D

Page visits: 2675

Time of last update: 2021-09-17 06:36:34

Author of last update: Jstuelk