SubtiWiki SubtiWiki
yxzE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yxzE
168

unknown

locus
BSU_38790
Molecular weight
6.70 kDa
pI
5.1
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yxzE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,982,973  3,983,173
Expression and Regulation
Operons
genes
[gene|8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06|yxzE]
description
[Pubmed|9987136]
regulation
repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|12076816]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12076816], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06|yxzE]

2021-09-01 00:36:08

ghost

1

71d0df0441a6a24394019d0f496ff555017e70c3

CEB01AC6C73D7D01584545BF740315A48BA01A9E

Biological materials
Mutant
BKE38790 ([gene|8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06|yxzE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCGCGTCACTCCCTTT,  downstream forward: _UP4_GGCGGCGATTAAACGCCGCC
BKK38790 ([gene|8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06|yxzE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTCGCGTCACTCCCTTT,  downstream forward: _UP4_GGCGGCGATTAAACGCCGCC
References
12884008,9987136,12076816

8C8DFC3CE03F8F3EE38376D42DD0D29ACE105A06

Page visits: 749

Time of last update: 2021-09-02 15:36:56

Author of last update: Bzhu