SubtiWiki SubtiWiki
ftsE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ftsE
168

[wiki|ABC transporter ](ATP-binding protein) ([protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]), required for [protein|search|CwlO ]activity (cell elongation) and for proper activation of [protein|search|Spo0A ]and initiation of [wiki|sporulation]

locus
BSU_35260
Molecular weight
25.47 kDa
pI
8.42
Protein length
Gene length
function
control of [wiki|cell wall synthesis]
product
[wiki|ABC transporter ](ATP-binding protein)
essential
no
synonyms
ftsE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2884

This gene is a member of the following regulons

Gene
Coordinates
3,624,821  3,625,507
Phenotypes of a mutant
a ''[gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]'' mutation is synthetically lethal with a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]
shorter, fatter cells, this can be rescued by addition of Mg(2+) [Pubmed|23869552,23855774]
reduced growth rate, especially at low Mg(2+) concentrations [Pubmed|23869552]
The protein
Catalyzed reaction/ biological activity
necessary for the autolysin activity of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [Pubmed|23855774]
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 2-227) (according to UniProt)
Structure
[PDB|3TIF] (ATP-binding protein from ''Methanococcus jannaschii'', 40% identity) [Pubmed|22158619]
Paralogous protein(s)
[protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY], [protein|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE], [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL], [protein|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA], [protein|0F8048267EC038D8CF673317D969BA27735473A7|yvrO]
[wiki|Localization]
membrane associated (via [protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]) [Pubmed|18573177]
Expression and Regulation
Operons
genes
[gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]-[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]
description
(according to [http://dbtbs.hgc.jp/COG/prom/ftsEX.html DBTBS]) null
regulation
repressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
Open in new tab

[gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]→[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]

2021-08-18 03:18:56

ghost

1

2cc5c6f6d5937ee06ba05b9f32e1806d70a64558

0160C162B03C88639486948C622D41CB46D2FE11

Biological materials
Mutant
BKE35260 ([gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAATCACCTAATCTTT,  downstream forward: _UP4_GAGTCAAGAGGGGAGTATGG
BKK35260 ([gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAAATCACCTAATCTTT,  downstream forward: _UP4_GAGTCAAGAGGGGAGTATGG
References
Reviews
33709487,33450852
Original Publications
10092453,18573177,22158619,14651647,23855774,23869552

8BF7EB539B53D75BD30BD30ABF27106D6A0B030B

Page visits: 2132

Time of last update: 2021-09-14 23:40:22

Author of last update: Jstuelk