SubtiWiki SubtiWiki
araP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

araP
168

[wiki|ABC transporter] for the uptake of -1,5-arabinooligosaccharides, at least up to four L-arabinosyl units (integral membrane protein)

locus
BSU_28740
Molecular weight
34.88 kDa
pI
9.69
Protein length
Gene length
function
uptake of -1,5-arabinooligosaccharides
product
-1,5-arabinooligosaccharide [wiki|ABC transporter] (integral membrane protein)
essential
no
synonyms
araP, yseD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1175

This gene is a member of the following regulons

Gene
Coordinates
2,940,697  2,941,638
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|MalFG subfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 87-302) (according to UniProt)
Structure
[PDB|2R6G] (from E. coli, 23% identity) [pubmed|18033289]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|028428CE456E283C065756878EA7C7DB495DD10D|araA]-[gene|E0525A4187D9C8A23F23BC8F883973896C8D295D|araB]-[gene|3859854178E573AE8ACCE6DF85E32C495D316DA1|araD]-[gene|BBAD1638F435791C1846EFFAD6B6F82CE491FDF1|araL]-[gene|16EE17461B4AB467A4F8172FD3E335073AD2B1D8|araM]-[gene|C1F5D0EA21DCA5F8EC43720CDF67E859CA7B866E|araN]-[gene|8AF43CA410F3381209196E1B9A4FE66D78020793|araP]-[gene|AE532A8931D516CC676E765D1D1293E73C335D23|araQ]-[gene|2B2629D275491A9F7031D5A99BAA001B011A765B|abfA]
description
[Pubmed|9084180]
regulation
induced by arabinose ([protein|search|AraR]) [Pubmed|10417639]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12949161], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|A567466894AE9DE7CDE7816615433A37532297B5|araR]: repression, [Pubmed|10417639], in [regulon|protein:A567466894AE9DE7CDE7816615433A37532297B5|araR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9084180], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|028428CE456E283C065756878EA7C7DB495DD10D|araA]→[gene|2B2629D275491A9F7031D5A99BAA001B011A765B|abfA]

2021-08-05 07:06:07

ghost

8

b7d3312ef868c449eb18db3a2b2bf36130567026

7BE2C086CD88758AEADFA2166B6FC6182EB55613

Biological materials
Mutant
MGNA-A986 (araP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/986 NBRP B. subtilis, Japan]
BKE28740 ([gene|8AF43CA410F3381209196E1B9A4FE66D78020793|araP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGAACCTCCCCGCTTT,  downstream forward: _UP4_GGCTCGTTTAAGGGGGAGGG
BKK28740 ([gene|8AF43CA410F3381209196E1B9A4FE66D78020793|araP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGAACCTCCCCGCTTT,  downstream forward: _UP4_GGCTCGTTTAAGGGGGAGGG
References
12884008,10092453,9084180,10417639,12949161,29240795,20693325,18033289,33177617

8AF43CA410F3381209196E1B9A4FE66D78020793

Page visits: 1280

Time of last update: 2021-09-13 13:12:31

Author of last update: TPed