SubtiWiki SubtiWiki
araP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

araP
168

[wiki|ABC transporter] for the uptake of -1,5-arabinooligosaccharides, at least up to four L-arabinosyl units (integral membrane protein)

locus
BSU_28740
Molecular weight
34.88 kDa
pI
9.69
Protein length
Gene length
function
uptake of -1,5-arabinooligosaccharides
product
-1,5-arabinooligosaccharide [wiki|ABC transporter] (integral membrane protein)
essential
no
synonyms
araP, yseD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1175

This gene is a member of the following regulons

Gene
Coordinates
2,940,697  2,941,638
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|MalFG subfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 87-302) (according to UniProt)
Structure
[PDB|2R6G] (from E. coli, 23% identity) [pubmed|18033289]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|028428CE456E283C065756878EA7C7DB495DD10D|araA]-[gene|E0525A4187D9C8A23F23BC8F883973896C8D295D|araB]-[gene|3859854178E573AE8ACCE6DF85E32C495D316DA1|araD]-[gene|BBAD1638F435791C1846EFFAD6B6F82CE491FDF1|araL]-[gene|16EE17461B4AB467A4F8172FD3E335073AD2B1D8|araM]-[gene|C1F5D0EA21DCA5F8EC43720CDF67E859CA7B866E|araN]-[gene|8AF43CA410F3381209196E1B9A4FE66D78020793|araP]-[gene|AE532A8931D516CC676E765D1D1293E73C335D23|araQ]-[gene|2B2629D275491A9F7031D5A99BAA001B011A765B|abfA]
description
[Pubmed|9084180]
regulation
induced by arabinose ([protein|search|AraR]) [Pubmed|10417639]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12949161], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|A567466894AE9DE7CDE7816615433A37532297B5|araR]: repression, [Pubmed|10417639], in [regulon|protein:A567466894AE9DE7CDE7816615433A37532297B5|araR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9084180], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|028428CE456E283C065756878EA7C7DB495DD10D|araA]→[gene|2B2629D275491A9F7031D5A99BAA001B011A765B|abfA]

2021-11-08 12:25:41

ghost

18

b7d3312ef868c449eb18db3a2b2bf36130567026

7BE2C086CD88758AEADFA2166B6FC6182EB55613

Biological materials
Mutant
MGNA-A986 (araP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/986 NBRP B. subtilis, Japan]
BKE28740 ([gene|8AF43CA410F3381209196E1B9A4FE66D78020793|araP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGAACCTCCCCGCTTT,  downstream forward: _UP4_GGCTCGTTTAAGGGGGAGGG
BKK28740 ([gene|8AF43CA410F3381209196E1B9A4FE66D78020793|araP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGAACCTCCCCGCTTT,  downstream forward: _UP4_GGCTCGTTTAAGGGGGAGGG
References
12884008,10092453,9084180,10417639,12949161,29240795,20693325,18033289,33177617

8AF43CA410F3381209196E1B9A4FE66D78020793

Page visits: 1310

Time of last update: 2021-12-04 09:26:04

Author of last update: TPed