SubtiWiki SubtiWiki
serA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

serA
168

phosphoglycerate dehydrogenase

locus
BSU_23070
Molecular weight
56.95 kDa
pI
5.62
Protein length
Gene length
function
biosynthesis of serine
product
phosphoglycerate dehydrogenase
essential
no
ec
1.1.1.95
synonyms
serA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1760

This gene is a member of the following regulons

Gene
Coordinates
2,411,086 2,412,663
Phenotypes of a mutant
auxotrophic for serine [pubmed|32743959]
The protein
Catalyzed reaction/ biological activity
3-phospho-D-glycerate + NAD+ --> 3-phosphooxypyruvate + H+ + NADH (according to UniProt)
(R)-2-hydroxyglutarate + NAD+ --> 2-oxoglutarate + H+ + NADH (according to UniProt)
Protein family
D-isomer specific 2-hydroxyacid dehydrogenase family (with [protein|B0145F4E13F004ECC773E8758B5844669F4C74D7|yvcT] and [protein|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD], according to UniProt)
[wiki|Domains]
[wiki|ACT domain] (aa 452-524) (according to UniProt)
Structure
[PDB|1YBA] (from ''E. coli'', 30% identity, 52% similarity) [Pubmed|15823035]
Modification
S-cysteinylation after diamide stress (C410)[Pubmed|17611193]
active site Cys410 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
[wiki|Localization]
membrane [Pubmed|18763711]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]
description
[Pubmed|7934830]
regulation
strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [pubmed|31138626], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]

2021-08-29 03:13:51

ghost

5

e2a49730f3ccfe1525cfbf70993222aff6a5014f

D6E645259BB5DFB4847B3C6AD03E39685A99FCC5

Biological materials
Mutant
GP2392 ''[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]''::''zeo'', available in [wiki|Jrg Stlke]'s lab [pubmed|32743959]
1A614 (''serA''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A614&Search=1A614 BGSC] and in [wiki|Jrg Stlke]'s lab
BKE23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
BKK23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
BP1273 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::kan trp+) available in [wiki|Jörg Stülke]'s & [wiki|Fabian Commichau]'s lab
lacZ fusion
pGP187 (in [wiki|pAC7]), available in [wiki|Jrg Stlke]'s lab
pGP2287 (in [wiki|pAC7]), available in [wiki|Jrg Stlke]'s lab
References
22938038,17611193,7934830,18763711,15823035,21749987,15378759,31138626,32743959

8AD1C7C761FF8B407A973381CA135C264B995CB7

Page visits: 2004

Time of last update: 2021-09-15 10:33:03

Author of last update: Melvin.boenninger