SubtiWiki SubtiWiki
serA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

serA
168

phosphoglycerate dehydrogenase

locus
BSU_23070
Molecular weight
56.95 kDa
pI
5.62
Protein length
Gene length
function
biosynthesis of serine
product
phosphoglycerate dehydrogenase
essential
no
ec
1.1.1.95
synonyms
serA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1760

This gene is a member of the following regulons

Gene
Coordinates
2,411,086 2,412,663
Phenotypes of a mutant
auxotrophic for serine [pubmed|32743959]
The protein
Catalyzed reaction/ biological activity
3-phospho-D-glycerate + NAD+ --> 3-phosphooxypyruvate + H+ + NADH (according to UniProt)
(R)-2-hydroxyglutarate + NAD+ --> 2-oxoglutarate + H+ + NADH (according to UniProt)
Protein family
D-isomer specific 2-hydroxyacid dehydrogenase family (with [protein|B0145F4E13F004ECC773E8758B5844669F4C74D7|yvcT] and [protein|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD], according to UniProt)
[wiki|Domains]
[wiki|ACT domain] (aa 452-524) (according to UniProt)
Structure
[PDB|1YBA] (from ''E. coli'', 30% identity, 52% similarity) [Pubmed|15823035]
Modification
S-cysteinylation after diamide stress (C410)[Pubmed|17611193]
active site Cys410 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
[wiki|Localization]
membrane [Pubmed|18763711]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]
description
[Pubmed|7934830]
regulation
strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [pubmed|31138626], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]

2021-11-28 11:06:16

ghost

10

e2a49730f3ccfe1525cfbf70993222aff6a5014f

D6E645259BB5DFB4847B3C6AD03E39685A99FCC5

Biological materials
Mutant
GP2392 ''[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]''::''zeo'', available in [wiki|Jrg Stlke]'s lab [pubmed|32743959]
1A614 (''serA''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A614&Search=1A614 BGSC] and in [wiki|Jrg Stlke]'s lab
BKE23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
BKK23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
BP1273 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::kan trp+) available in [wiki|Jörg Stülke]'s & [wiki|Fabian Commichau]'s lab
lacZ fusion
pGP187 (in [wiki|pAC7]), available in [wiki|Jrg Stlke]'s lab
pGP2287 (in [wiki|pAC7]), available in [wiki|Jrg Stlke]'s lab
References
22938038,17611193,7934830,18763711,15823035,21749987,15378759,31138626,32743959

8AD1C7C761FF8B407A973381CA135C264B995CB7

Page visits: 2089

Time of last update: 2021-12-04 08:47:46

Author of last update: Melvin.boenninger