SubtiWiki SubtiWiki
comZ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

comZ
168

late competence gene

locus
BSU_11310
Molecular weight
7.08 kDa
pI
4.37
Protein length
Gene length
function
compentence
product
unknown
essential
no
ec
null
synonyms
comZ, yjzA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,207,597  1,207,788
Expression and Regulation
Operons
genes
[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
description
[Pubmed|22383849]
Open in new tab

[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]

2021-06-30 06:38:48

Jstuelk

3

ed54a845f8eabc16df1f8aa223e9b6618f2aa9f8

0CBFA749EC8F7586EDA16E9229CFFED00BD1120E

genes
[gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]-[gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]-[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
description
[pubmed|22383849]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]->[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]

2021-08-22 22:03:16

Bzhu

3

96bbde0fab9686c9611ee937310c9ee14bc9660c

229F31AF8CB2DB513EEB5E7E9812DC533EF51AEE

genes
[gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]-[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
description
[Pubmed|9335269]
regulation
repressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9335269], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]→[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]

2021-07-14 11:40:40

ghost

2

59ed9d4827fed8cc173654932418cb19c7fa8d5d

73AE85AA2203B05C4FE3B47EFB655AD7999F34DB

genes
[gene|2BF1CA62F5B8B54A25B70721D39B5BD38C0203EB|yjaU]-[gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]-[gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]-[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
description
[Pubmed|22383849]
Open in new tab

[gene|2BF1CA62F5B8B54A25B70721D39B5BD38C0203EB|yjaU]->[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]

2021-09-12 19:13:18

Jstuelk

5

d691d7285529fe70ca653bff9af1cfb1b815b70a

C6B12BC76A78C50ADA8A84738A7AF27D7330A58B

Biological materials
Mutant
BKE11310 ([gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTCGTGCTGCATGTGAC,  downstream forward: _UP4_TAAGAAGAAGCCACTTTTTT
BKK11310 ([gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTCGTGCTGCATGTGAC,  downstream forward: _UP4_TAAGAAGAAGCCACTTTTTT
References
10940045,9335269,14651647

8914DE1312FD3C28E7D451A034814D92D1312B10

Page visits: 1376

Time of last update: 2021-09-04 08:20:20

Author of last update: Bzhu