SubtiWiki SubtiWiki
bmrU

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

bmrU
168

general stress protein, multidrug resistance protein, similar to diacylglycerol kinase

locus
BSU_24000
Molecular weight
32.31 kDa
pI
5.39
Protein length
Gene length
function
multidrug resistance
product
multidrug resistance protein
essential
no
ec
null
synonyms
bmrU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1597

This gene is a member of the following regulons

Gene
Coordinates
2,493,662  2,494,555
The protein
Protein family
diacylglycerol/lipid kinase family (with [protein|943294ACA74067A8549056699E08DF5B82337976|dgkB] and [protein|ED4C1EA16FF96DA20F12B972CD2458FA3B49DDA5|ytlR], according to UniProt)
[wiki|Domains]
DAGKc domain (1-132) (according to UniProt)
Structure
[PDB|3S40] (from ''B. anthracis'', 39% identity, 73% similarity)
Paralogous protein(s)
[protein|943294ACA74067A8549056699E08DF5B82337976|dgkB]
Expression and Regulation
Operons
genes
[gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]-[gene|ADBC0F194B601F736492E54011E0A68351B5BD39|bmr]-[gene|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|bmrR]
description
[Pubmed|10220166]
regulation
''[protein|search|bmrU]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]→[gene|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|bmrR]

2021-10-12 15:46:11

ghost

4

2e647ad1226b497eeb1c22896849b452c0b79a82

C61FA43F89F0BEC555BDAD8ACACFBD6D473F57AD

Biological materials
Mutant
BKE24000 ([gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATACAACTGCTCCTTTA,  downstream forward: _UP4_TAACTGTCATAAGGCTTTAG
BKK24000 ([gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATACAACTGCTCCTTTA,  downstream forward: _UP4_TAACTGTCATAAGGCTTTAG
References
10220166,11544224

88AECCE90DC0D6C92C61AB8860A31A830A8DAC42

Page visits: 1437

Time of last update: 2021-10-14 05:16:52

Author of last update: Melvin.boenninger