SubtiWiki SubtiWiki
cheW

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

cheW
168

modulation of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA] activity in response to attractants, scaffold protein

locus
BSU_16440
Molecular weight
17.36 kDa
pI
4.42
Protein length
Gene length
function
control of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA] activity
product
CheA modulator
essential
no
synonyms
cheW

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0835

This gene is a member of the following regulons

Gene
Coordinates
1,714,855  1,715,325
Phenotypes of a mutant
''[gene|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV] [gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]'' double mutants exhibit complete loss of chemotaxis [Pubmed|21098025]
The protein
[wiki|Domains]
CheW-like domain (aa 8-148) (according to UniProt)
Structure
[PDB|2HO9] (from E. coli, 28% identity)
Paralogous protein(s)
[protein|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV], (N-terminal domain of CheV)
[wiki|Localization]
cytoplasm (according to UniProt)
predominantly present at the cell poles [Pubmed|21098025]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
Expression and Regulation
Operons
genes
[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
description
[Pubmed|20233303]
regulation
see [wiki|fla-che operon]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]: activation, in [regulon|protein:5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9657996], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|20233303], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]→[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]

2021-11-20 22:15:54

Jstuelk

31

EECFE9022742ECC57D9BBA5CE7DB7A4D1BFD42A8

0535E3D13CBD000A94D62050515BF8D1D5E3F011

genes
[gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]-[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]-[gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]-[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]-[gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]-[gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]-[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]-[gene|600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC|fliJ]-[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
description
[Pubmed|9657996,8157612,15175317]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]: activation, in [regulon|protein:5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9657996], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|9657996], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]→[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]

2021-11-27 17:52:01

Jstuelk

25

024d59ae468aa14568753f57122b789c39ed6c06

4D920B925DA071AE7390E022B9AB625E40B7B2AC

Biological materials
Mutant
BKE16440 ([gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAGACACCTCCTCGA,  downstream forward: _UP4_GCTTAATCTTAAAGGGGTTA
BKK16440 ([gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAGACACCTCCTCGA,  downstream forward: _UP4_GCTTAATCTTAAAGGGGTTA
References
Reviews
20122866
Original Publications
8169224,1601874,14731274,1624415,14651647,9657996,8157612,15175317,17850253,21098025,21515776,24386445,25039821

887D84520DF3D5F22DED525C1C17130EDE60DC36

Page visits: 1405

Time of last update: 2021-11-28 00:53:11

Author of last update: Melvin.boenninger