SubtiWiki SubtiWiki
capB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

capB
168

part of the [protein|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[protein|D66994D077D1382B88FF65075E44C2A31089548F|capC] glutmic acid ligase, capsular polyglutamate biosynthesis

locus
BSU_35900
Molecular weight
43.79 kDa
pI
5.07
Protein length
Gene length
function
capsule synthesis
product
poly-gamma-glutamate synthetase
essential
no
synonyms
capB, ywsC, pgsB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0771

This gene is a member of the following regulons

Gene
Coordinates
3,699,446  3,700,627
Phenotypes of a mutant
no synthesis of the poly-gamma-glutamate capsule [Pubmed|11751809]
The protein
Catalyzed reaction/ biological activity
synthesis of poly-gamma-glutamate from L-Glu [Pubmed|11751809]
Expression and Regulation
Operons
genes
[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]
description
[Pubmed|11751809]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|19734658], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|19420703], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
expression of the operon is increased in '[protein|search|motA]' or '[protein|search|motB]' mutants due to increased [protein|search|DegU] phosphorylation [PubMed|24296669]
Open in new tab

[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]→[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]

2021-07-25 05:58:38

ghost

1

bf6b0bf03353d832d0fb99e09c0c2fcd8af8f057

1302D3190C59C849B9803B3A11C008FA08B67E54

Biological materials
Mutant
MGNA-B262 (ywsC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1261 NBRP B. subtilis, Japan]
BKE35900 ([gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTCGACATCTCC,  downstream forward: _UP4_GTAAGCTAGGGGGAAATGCA
BKK35900 ([gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTCGACATCTCC,  downstream forward: _UP4_GTAAGCTAGGGGGAAATGCA
References
Reviews
20735481,16689787,29215550
Original Publications
11751809,19420703,19389763,16233197,19734658,20564357,20564574,24296669,21965392,27073802,29971620,30295732,31837088,16278834

86C05126ADBA22BB1771B1FA3D214B2E7A36311E

Page visits: 2633

Time of last update: 2021-09-19 02:53:14

Author of last update: Jstuelk