SubtiWiki SubtiWiki
yceE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yceE
168

general stress protein, similar to tellurium resistance protein

locus
BSU_02910
Molecular weight
20.80 kDa
pI
4.39
Protein length
Gene length
function
required for survival of ethanol stress and at low temperatures
product
unknown
essential
no
synonyms
yceE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2310

This gene is a member of the following regulons

Gene
Coordinates
313,396  313,974
The protein
Protein family
CAPAB/TerDEXZ family (with [protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC] and [protein|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD], according to UniProt)
Structure
[PDB|2KXT] (from Klebsiella pneumoniae, 54% identity) [pubmed|21112337]
Modification
phosphorylated on Arg-10 [Pubmed|22517742]
Paralogous protein(s)
[protein|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD], [protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]
Expression and Regulation
Operons
genes
[gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]-[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]-[gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]-[gene|F16A11027D8D320D3D64E44038E29921A946955B|yceF]-[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]-[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]
description
[Pubmed|11866510]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|19047346], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]→[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]

2021-08-14 10:31:02

ghost

1

1557da8d91643a69a9cc817172bc649767baab90

35ADA58FA11FB35C1D0420A579F4F2F0CD877167

Biological materials
Mutant
MGNA-B985 (yceE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1984 NBRP B. subtilis, Japan]
BKE02910 ([gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTGCCTCTCTCCTTTC,  downstream forward: _UP4_TAAGCGAGTGACAAATAGAG
BKK02910 ([gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02910 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTGCCTCTCTCCTTTC,  downstream forward: _UP4_TAAGCGAGTGACAAATAGAG
References
15805528,11866510,18179421,19047346,22517742,21112337

863E26D497D29B820912A0C0F4A3AE4C6865EC2E

Page visits: 1567

Time of last update: 2021-09-01 13:56:58

Author of last update: Melvin.boenninger