SubtiWiki SubtiWiki
yyaN

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yyaN
168

similar to transcriptional regulator ([wiki|MerR family])

locus
BSU_40800
Molecular weight
15.91 kDa
pI
9.31
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yyaN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0789

This gene is a member of the following regulons

Gene
Coordinates
4,189,796  4,190,212
The protein
Protein family
[wiki|MerR family]
[wiki|Domains]
[wiki|HTH merR-type domain] (aa 3-72) (according to UniProt)
Structure
[PDB|3QAO] (from Listeria monocytogenes, 29% identity)
Expression and Regulation
Operons
genes
[gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]-[gene|D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C|yyaM]-[gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]
description
[Pubmed|22383849]
Open in new tab

[gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]→[gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]

2021-10-06 16:36:38

Jstuelk

4

dae36084e0a18eee42d8f69fcaaf519fcef43d33

C86B2672974B1551D3E5779BC0C0D78FB55E202D

additional information
translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Biological materials
Mutant
MGNA-B860 (yyaN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1859 NBRP B. subtilis, Japan]
BKE40800 ([gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCTCTCATTTAAT,  downstream forward: _UP4_TTGAAAGAGGAAGTGGAAAA
BKK40800 ([gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCTCTCATTTAAT,  downstream forward: _UP4_TTGAAAGAGGAAGTGGAAAA

852ECFA6F254167090AA393E6E0D269F49A4CC6E

Page visits: 979

Time of last update: 2021-10-09 19:23:17

Author of last update: Melvin.boenninger