SubtiWiki SubtiWiki
pksR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pksR
168

polyketide synthase

locus
BSU_17220
Molecular weight
284.73 kDa
pI
5.44
Protein length
Gene length
function
polyketide synthesis
product
polyketide synthase
essential
no
synonyms
pksR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3321

This gene is a member of the following regulons

Gene
Coordinates
1,850,890  1,858,521
The protein
[wiki|Domains]
3 [wiki|Carrier domain]s (aa 376-452, aa 1407-1485, aa 2134-2208) (according to UniProt)
Structure
[PDB|4U3V] (enoyl-isomerase domain, aa 1124-1395) [Pubmed|25089587]
Expression and Regulation
Operons
genes
[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
description
[Pubmed|22383849]
regulation
expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab

[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]→[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]

2021-09-08 19:44:39

ghost

13

74bf817d9000509d225bbbcac6c8a0a9eabeb843

1475C94AAA2C10C6BE3CA0873EFBD171EC2E2513

genes
[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
description
[pubmed|22383849]
Open in new tab

[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]→[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]

2021-07-13 10:48:16

Jstuelk

9

c851e07b7201353cf026d8929ea66cff6bbb92e2

D95CF77A7673AA84CC653095A1FB017D490049D6

Biological materials
Mutant
MGNA-A018 (pksR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/18 NBRP B. subtilis, Japan]
BKE17220 ([gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTCAGCATTGGCGTTTCCC,  downstream forward: _UP4_TGAGAAAACACAAACGCCCC
BKK17220 ([gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTCAGCATTGGCGTTTCCC,  downstream forward: _UP4_TGAGAAAACACAAACGCCCC
References
10960106,25089587,17190806,22383849,24187085

85213235F7D3D8E711963E53F314ED758B5FA94B

Page visits: 2000

Time of last update: 2021-09-15 10:34:55

Author of last update: Melvin.boenninger