SubtiWiki SubtiWiki
pksR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

pksR
168

polyketide synthase

locus
BSU_17220
Molecular weight
284.73 kDa
pI
5.44
Protein length
Gene length
function
polyketide synthesis
product
polyketide synthase
essential
no
synonyms
pksR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3321

This gene is a member of the following regulons

Gene
Coordinates
1,850,890  1,858,521
The protein
[wiki|Domains]
3 [wiki|Carrier domain]s (aa 376-452, aa 1407-1485, aa 2134-2208) (according to UniProt)
Structure
[PDB|4U3V] (enoyl-isomerase domain, aa 1124-1395) [Pubmed|25089587]
Expression and Regulation
Operons
genes
[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
description
[Pubmed|22383849]
regulation
expressed during the transition from growth to stationary phase ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|24187085]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|24187085], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|24187085], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
this is a very large operon comprising about 75 kb
Open in new tab

[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]→[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]

2021-11-08 13:54:58

Jstuelk

25

74BF817D9000509D225BBBCAC6C8A0A9EABEB843

1475C94AAA2C10C6BE3CA0873EFBD171EC2E2513

genes
[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
description
[pubmed|22383849]
Open in new tab

[gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]→[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]

2021-12-01 13:07:45

Jstuelk

23

c851e07b7201353cf026d8929ea66cff6bbb92e2

D95CF77A7673AA84CC653095A1FB017D490049D6

Biological materials
Mutant
MGNA-A018 (pksR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/18 NBRP B. subtilis, Japan]
BKE17220 ([gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTCAGCATTGGCGTTTCCC,  downstream forward: _UP4_TGAGAAAACACAAACGCCCC
BKK17220 ([gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTCAGCATTGGCGTTTCCC,  downstream forward: _UP4_TGAGAAAACACAAACGCCCC
References
10960106,25089587,17190806,22383849,24187085

85213235F7D3D8E711963E53F314ED758B5FA94B

Page visits: 2064

Time of last update: 2021-12-04 09:39:46

Author of last update: Melvin.boenninger