SubtiWiki SubtiWiki
ybfA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ybfA
168

unknown

locus
BSU_02160
Molecular weight
35.60 kDa
pI
5.85
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybfA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
235,965  236,882
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 1-140) (according to UniProt)
[wiki|N-acetyltransferase domain] (aa 153-303) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]-[gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]-[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]
description
[Pubmed|22383849]
Open in new tab

[gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]→[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]

2020-11-06 12:56:32

Jstuelk

0

1afc5a31aeaa2255359589aa12a176cd49ea7172

3F7981DE9DCD035C47FD3E3F5BD5AAFABA36FBEE

genes
[gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]-[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]
description
[Pubmed|22383849]
Open in new tab

[gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]→[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]

2021-07-24 08:10:30

Jstuelk

2

848873d507d2304f32f5369e6858db2d73aa05a7

5F9B16191C0A3430E86B3DB70ABB2FB8F9B51B93

Biological materials
Mutant
MGNA-B964 (ybfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1963 NBRP B. subtilis, Japan]
BKE02160 ([gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATCAATTCCCACTTTCT,  downstream forward: _UP4_GAACGGTGGGATTTGGAGCT
BKK02160 ([gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02160 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATCAATTCCCACTTTCT,  downstream forward: _UP4_GAACGGTGGGATTTGGAGCT

84BD1259552AAC6FBDE42221B42F57DEFF3622E8

Page visits: 948

Time of last update: 2021-10-24 04:45:14

Author of last update: Melvin.boenninger