SubtiWiki SubtiWiki
yvdT

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yvdT
168

similar to transcriptional regulator ([wiki|TetR family])

locus
BSU_34480
Molecular weight
22.08 kDa
pI
5.3
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yvdT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
3,540,822  3,541,406
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 6-66) (according to UniProt)
Structure
[PDB|2F07]
Expression and Regulation
Operons
genes
[gene|8417C205E756C27D25BCEA9394DEB0968B5F4F7B|yvdT]-[gene|FDE9E1E86BA06B4CE782CBA32F113D302A0B2231|yvdS]-[gene|18CBED273AD7787971073117DFA0B89BDF149B25|yvdR]
description
[Pubmed|22383849]
Open in new tab

[gene|8417C205E756C27D25BCEA9394DEB0968B5F4F7B|yvdT]→[gene|18CBED273AD7787971073117DFA0B89BDF149B25|yvdR]

2021-10-03 13:18:20

Jstuelk

3

1b3e50dddbc6cea33557d614c43c379ad9551d6a

363164D2584B836A44C7C269AD6EB7DF366C5946

genes
[gene|8417C205E756C27D25BCEA9394DEB0968B5F4F7B|yvdT]
description
[Pubmed|22383849]
Open in new tab

[gene|8417C205E756C27D25BCEA9394DEB0968B5F4F7B|yvdT]

2020-11-06 12:56:32

Jstuelk

0

59cc778e2a44bbfcfc38f6a4d2ab3f4c3077352d

B856F452A13407C46E63E82B9DD31795F55C93AF

Biological materials
Mutant
MGNA-B616 (yvdT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1615 NBRP B. subtilis, Japan]
BKE34480 ([gene|8417C205E756C27D25BCEA9394DEB0968B5F4F7B|yvdT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGGAACACCTCCAGTA,  downstream forward: _UP4_TAAAAAATGACTGGGTAACA
BKK34480 ([gene|8417C205E756C27D25BCEA9394DEB0968B5F4F7B|yvdT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGGAACACCTCCAGTA,  downstream forward: _UP4_TAAAAAATGACTGGGTAACA
References
Reviews
24006471

8417C205E756C27D25BCEA9394DEB0968B5F4F7B

Page visits: 829

Time of last update: 2021-10-13 13:57:37

Author of last update: Melvin.boenninger