SubtiWiki SubtiWiki
iolW

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

iolW
168

scyllo-inositol dehydrogenase, general stress protein

locus
BSU_33530
Molecular weight
39.95 kDa
pI
5.46
Protein length
Gene length
function
utilization of scyllo-inosose
product
scyllo-inositol dehydrogenase
essential
no
synonyms
iolW, yvaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0673

This gene is a member of the following regulons

Gene
Coordinates
3,444,329  3,445,405
The protein
Catalyzed reaction/ biological activity
NADPH-dependent conversion of scyllo-inosose to scyllo-inositol [pubmed|20133360]
NADP+ + scyllo-inositol --> H+ + NADPH + scyllo-inosose (according to UniProt)
Protein family
[wiki|Gfo/Idh/MocA family] (according to UniProt)
[wiki|Cofactors]
NADP+ [pubmed|20133360]
Structure
[PDB|3GFG]
Paralogous protein(s)
[protein|920C5750CB95102B073C32874D512E8D636D2C7D|iolU], [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG], [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|yrbE], [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX], [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT]
Expression and Regulation
Operons
genes
[gene|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW]
description
[pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW]

2021-06-14 15:46:24

Bzhu

3

f7d2c023074100be48758159f46bfe56fa945673

9AD1D5A966A01BF716D22ECF21595BAF992727ED

Biological materials
Mutant
MGNA-A443 (iolU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/443 NBRP B. subtilis, Japan]
BKE33530 ([gene|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACAGAAGTATATACCCTC,  downstream forward: _UP4_TAAAACAAAAGCCTCCCCAA
BKK33530 ([gene|7DFE74C751A67CCC84579D52005E1399B0A10166|iolW]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACAGAAGTATATACCCTC,  downstream forward: _UP4_TAAAACAAAAGCCTCCCCAA
References
15805528,20133360,24325193

7DFE74C751A67CCC84579D52005E1399B0A10166

Page visits: 1716

Time of last update: 2021-10-20 17:36:37

Author of last update: Melvin.boenninger