SubtiWiki SubtiWiki
ywbH
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywbH
168

holin-like protein

locus
BSU_38320
Molecular weight
14.12 kDa
pI
9.59
Protein length
Gene length
function
unknown
product
holin-like protein
essential
no
synonyms
ywbH, ipa-23r, cidA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1380

This gene is a member of the following regulons

Gene
Coordinates
3,933,209  3,933,595
Phenotypes of a mutant
a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG]'' mutant is delayed in pellicle formation [Pubmed|26060272]
a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] [gene|E5E431AC5A7D03EEFF6D694CB25EED1570D739A2|yxaK]-[gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC] [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' triple mutant is severely delayed in pellicle formation [Pubmed|26060272]
a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG]'' overexpression strain has more robust pellicle formation [Pubmed|26060272]
The protein
Protein family
CidA/LrgA family (with [protein|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA], according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG]
description
[Pubmed|22383849]
regulation
induced by acetate ([protein|search|YwbI]) [Pubmed|26060272]
regulatory mechanism
[protein|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]: activation, [Pubmed|26060272], in [regulon|protein:CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI regulon]
Open in new tab

[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]→[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG]

2021-08-21 19:14:02

ghost

4

8b888b7f95218c39ab633b66f41839b48b0e4a12

C0F3774C83BBD0BC954BE909C2A1F2245DF796C1

Biological materials
Mutant
MGNA-B225 (ywbH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1224 NBRP B. subtilis, Japan]
BKE38320 ([gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGCCTCCCTTAT,  downstream forward: _UP4_AAGAGAAAGGAGAAAAAGCA
BKK38320 ([gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGCCTCCCTTAT,  downstream forward: _UP4_AAGAGAAAGGAGAAAAAGCA
References
26060272,15659658,17452642

7DA08C189F5524D4874E2F4828264AB2671A5460

Page visits: 1271

Time of last update: 2021-09-16 18:42:39

Author of last update: Melvin.boenninger