SubtiWiki SubtiWiki
ywbH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ywbH
168

holin-like protein

locus
BSU_38320
Molecular weight
14.12 kDa
pI
9.59
Protein length
Gene length
function
unknown
product
holin-like protein
essential
no
synonyms
ywbH, ipa-23r, cidA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1380

This gene is a member of the following regulons

Gene
Coordinates
3,933,209  3,933,595
Phenotypes of a mutant
a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG]'' mutant is delayed in pellicle formation [Pubmed|26060272]
a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] [gene|E5E431AC5A7D03EEFF6D694CB25EED1570D739A2|yxaK]-[gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC] [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' triple mutant is severely delayed in pellicle formation [Pubmed|26060272]
a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG]'' overexpression strain has more robust pellicle formation [Pubmed|26060272]
The protein
Protein family
CidA/LrgA family (with [protein|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA], according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG]
description
[Pubmed|22383849]
regulation
induced by acetate ([protein|search|YwbI]) [Pubmed|26060272]
regulatory mechanism
[protein|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]: activation, [Pubmed|26060272], in [regulon|protein:CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI regulon]
Open in new tab

[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]→[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG]

2021-12-06 05:49:57

ghost

7

8b888b7f95218c39ab633b66f41839b48b0e4a12

C0F3774C83BBD0BC954BE909C2A1F2245DF796C1

Biological materials
Mutant
MGNA-B225 (ywbH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1224 NBRP B. subtilis, Japan]
BKE38320 ([gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGCCTCCCTTAT,  downstream forward: _UP4_AAGAGAAAGGAGAAAAAGCA
BKK38320 ([gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGCCTCCCTTAT,  downstream forward: _UP4_AAGAGAAAGGAGAAAAAGCA
References
26060272,15659658,17452642

7DA08C189F5524D4874E2F4828264AB2671A5460

Page visits: 1292

Time of last update: 2021-12-08 21:15:38

Author of last update: Melvin.boenninger