SubtiWiki SubtiWiki
yjbA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjbA
168

unknown

locus
BSU_11410
Molecular weight
29.97 kDa
pI
5.15
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yjbA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5917

This gene is a member of the following regulons

Gene
Coordinates
1,217,326  1,218,078
The protein
Protein family
UPF0736 family (single member, according to UniProt)
Expression and Regulation
Operons
genes
[gene|7CFDFB42AF816FF5766086E537472008E6CB7E85|yjbA]
description
[pubmed|22383849]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|7CFDFB42AF816FF5766086E537472008E6CB7E85|yjbA]

2020-11-06 12:56:32

Bzhu

0

6c5f504559d866662578ad2fdd41d4dc8521a4ef

AA878BAF02EDC0AADFDE52F4CC5C852C3DDD4649

Biological materials
Mutant
MGNA-B149 (yjbA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1148 NBRP B. subtilis, Japan]
BKE11410 ([gene|7CFDFB42AF816FF5766086E537472008E6CB7E85|yjbA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTAACCCCTCACTTT,  downstream forward: _UP4_TGAAAAAAACCGCTCTTTGC
BKK11410 ([gene|7CFDFB42AF816FF5766086E537472008E6CB7E85|yjbA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTAACCCCTCACTTT,  downstream forward: _UP4_TGAAAAAAACCGCTCTTTGC
References
16497325

7CFDFB42AF816FF5766086E537472008E6CB7E85

Page visits: 942

Time of last update: 2021-09-18 11:46:07

Author of last update: Melvin.boenninger