SubtiWiki SubtiWiki
yhjO
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhjO
168

similar to multidrug-efflux transporter

locus
BSU_10580
Molecular weight
43.90 kDa
pI
9.69
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhjO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,132,179  1,133,384
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-B287 (yhjO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1286 NBRP B. subtilis, Japan]
BKE10580 ([gene|7CF92AB56695063A3061E1380929A76E675243F7|yhjO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCGCCTTTCG,  downstream forward: _UP4_TAGAAAATAATTCATAATTT
BKK10580 ([gene|7CF92AB56695063A3061E1380929A76E675243F7|yhjO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCGCCTTTCG,  downstream forward: _UP4_TAGAAAATAATTCATAATTT

7CF92AB56695063A3061E1380929A76E675243F7

Page visits: 1115

Time of last update: 2021-07-26 15:50:40

Author of last update: Melvin.boenninger