SubtiWiki SubtiWiki
mcsB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mcsB
168

protein arginine kinase, adaptor protein, forms a gated kinase chamber to mark aberrant bacterial proteins for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP], modulator of [protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-dependent repression

locus
BSU_00850
Molecular weight
40.97 kDa
pI
5.07
Protein length
Gene length
function
control of [protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR] activity
product
protein arginine kinase
essential
no
synonyms
mcsB, yacI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3869

This gene is a member of the following regulons

Gene
Coordinates
102,484  103,575
Phenotypes of a mutant
more rapid spore germination as compared to wild type cells [pubmed|31221751]
The protein
Catalyzed reaction/ biological activity
phosphorylates and thereby targets non-functional [protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR] for degradation by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]/[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] [Pubmed|20852588]
phosphorylates and thereby targets [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR] for degradation by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]/[protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX] [Pubmed|32477307]
forms a gated kinase chamber to mark aberrant bacterial proteins for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] [pubmed|34328418]
ATP + L-arginyl-[protein] --> ADP + H+ + Nω-phospho-L-arginyl-[protein] (according to UniProt)
Protein family
ATP:guanido phosphotransferase family (single member, according to UniProt)
[wiki|Domains]
Phosphagen kinase C-terminal (aa 24-254) (according to UniProt)
Structure
[PDB|6TV6] (octameric [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]) [pubmed|34328418]
[PDB|6FH1] (from Geobacillus stearothermophilus) [pubmed|30962626]
[PDB|6FH3] (pArg-bound state, from Geobacillus stearothermophilus) [pubmed|30962626]
Modification
autophosphorylation on specific arginine residues [Pubmed|20852588,21622759], dephosphorylation by [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE] [Pubmed|20852588,21622759]
autophosphorylation stimulates [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB] activity as adaptor protein for [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] [Pubmed|21622759]
[wiki|Localization]
cytoplasm (according to UniProt)
Expression and Regulation
Operons
genes
[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
description
[Pubmed|8793870]
regulation
expressed during germination and spore outgrowth [Pubmed|24244006]
regulatory mechanism
[protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|protein:908DB17A39D518E84977250C55825E77FA02E391|ctsR regulon]
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [pubmed|30962353], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|17434969], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8793870], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]→[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]

2021-12-04 00:42:48

Bzhu

25

b7066b5ca5004b095502d71420c469e9ee925bfa

163769A1708F45F8ABE642374A97FA8A00293529

Biological materials
Mutant
MGNA-B930 (yacI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1929 NBRP B. subtilis, Japan]
''mcsB::aphA3'' availbale from the Gerth lab
mcsBC167S::spec available from the Gerth lab
GP1457 (''mcsB''::''aphA3''),  available in [wiki|Jörg Stülke]'s lab
BP69 (spc), available in [wiki|Fabian Commichau]'s lab
BKE00850 ([gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG,  downstream forward: _UP4_AAAAGACAGGAGGATGAATC
BKK00850 ([gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG,  downstream forward: _UP4_AAAAGACAGGAGGATGAATC
Expression vectors
for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
expression of native ''mcsB'' in ''B. subtilis'': pBP186 (in [wiki|pBQ200]), available in [wiki|Fabian Commichau]'s lab
Antibody
available in Gerth lab
labs
[wiki|Ulf Gerth], Greifswald, Germany
References
Reviews
23375660,19609260,28748186,34500011
Original Publications
17380125,16163393,19498169,11179229,9987115,8793870,16497325,19226326,9987115,11544224,20852588,21622759,22517742,24825175,24263382,25610436,26458230,27749819,30962626,31221751,32477307,33101263,34328418

7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948

Page visits: 4067

Time of last update: 2021-12-04 00:46:47

Author of last update: Jstuelk