SubtiWiki SubtiWiki
mcsB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mcsB
168

protein arginine kinase, adaptor protein, forms a gated kinase chamber to mark aberrant bacterial proteins for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP], modulator of [protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-dependent repression

locus
BSU_00850
Molecular weight
40.97 kDa
pI
5.07
Protein length
Gene length
function
control of [protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR] activity
product
protein arginine kinase
essential
no
synonyms
mcsB, yacI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3869

This gene is a member of the following regulons

Gene
Coordinates
102,484  103,575
Phenotypes of a mutant
more rapid spore germination as compared to wild type cells [pubmed|31221751]
The protein
Catalyzed reaction/ biological activity
phosphorylates and thereby targets non-functional [protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR] for degradation by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]/[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] [Pubmed|20852588]
phosphorylates and thereby targets [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR] for degradation by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]/[protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX] [Pubmed|32477307]
forms a gated kinase chamber to mark aberrant bacterial proteins for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] [pubmed|34328418]
ATP + L-arginyl-[protein] --> ADP + H+ + Nω-phospho-L-arginyl-[protein] (according to UniProt)
Protein family
ATP:guanido phosphotransferase family (single member, according to UniProt)
[wiki|Domains]
Phosphagen kinase C-terminal (aa 24-254) (according to UniProt)
Structure
[PDB|6TV6] (octameric [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]) [pubmed|34328418]
[PDB|6FH1] (from Geobacillus stearothermophilus) [pubmed|30962626]
[PDB|6FH3] (pArg-bound state, from Geobacillus stearothermophilus) [pubmed|30962626]
Modification
autophosphorylation on specific arginine residues [Pubmed|20852588,21622759], dephosphorylation by [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE] [Pubmed|20852588,21622759]
autophosphorylation stimulates [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB] activity as adaptor protein for [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] [Pubmed|21622759]
[wiki|Localization]
cytoplasm (according to UniProt)
Expression and Regulation
Operons
genes
[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
description
[Pubmed|8793870]
regulation
expressed during germination and spore outgrowth [Pubmed|24244006]
regulatory mechanism
[protein|908DB17A39D518E84977250C55825E77FA02E391|ctsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|protein:908DB17A39D518E84977250C55825E77FA02E391|ctsR regulon]
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [pubmed|30962353], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|17434969], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8793870], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]→[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]

2021-08-27 12:54:27

Bzhu

13

b7066b5ca5004b095502d71420c469e9ee925bfa

163769A1708F45F8ABE642374A97FA8A00293529

Biological materials
Mutant
MGNA-B930 (yacI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1929 NBRP B. subtilis, Japan]
''mcsB::aphA3'' availbale from the Gerth lab
mcsBC167S::spec available from the Gerth lab
GP1457 (''mcsB''::''aphA3''),  available in [wiki|Jörg Stülke]'s lab
BP69 (spc), available in [wiki|Fabian Commichau]'s lab
BKE00850 ([gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG,  downstream forward: _UP4_AAAAGACAGGAGGATGAATC
BKK00850 ([gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00850 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG,  downstream forward: _UP4_AAAAGACAGGAGGATGAATC
Expression vectors
for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
expression of native ''mcsB'' in ''B. subtilis'': pBP186 (in [wiki|pBQ200]), available in [wiki|Fabian Commichau]'s lab
Antibody
available in Gerth lab
labs
[wiki|Ulf Gerth], Greifswald, Germany
References
Reviews
23375660,19609260,28748186,34500011
Original Publications
17380125,16163393,19498169,11179229,9987115,8793870,16497325,19226326,9987115,11544224,20852588,21622759,22517742,24825175,24263382,25610436,26458230,27749819,30962626,31221751,32477307,33101263,34328418

7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948

Page visits: 4034

Time of last update: 2021-09-16 14:25:59

Author of last update: Jstuelk