SubtiWiki SubtiWiki
mdtR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mdtR
168

transcription repressor of the multidrug-resistance [gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|search|mdtP ]operon

locus
BSU_32870
Molecular weight
17.26 kDa
pI
6.38
Protein length
Gene length
function
regulation of the multidrug-resistance [gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|search|mdtP ]operon
product
transcription repressor ([wiki|MarR family])
essential
no
synonyms
mdtR, yusO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
3,374,492  3,374,959
The protein
Protein family
[wiki|MarR family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 4-140) (according to UniProt)
Structure
[PDB|1S3J]
Expression and Regulation
Operons
genes
[gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]
description
[Pubmed|19286808]
regulatory mechanism
[protein|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]: repression, [Pubmed|19286808], in [regulon|protein:795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR regulon]
Open in new tab

[gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]→[gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]

2021-07-28 03:36:20

ghost

3

e8ef0633959f1f2e66057727f720be97f7312a4d

F311909F49C8D0FC01C8D2C80963778BC55777F7

Biological materials
Mutant
MGNA-B595 (yusO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1594 NBRP B. subtilis, Japan]
GP1115 (spc), available in [wiki|Jörg Stülke]'s lab
BKE32870 ([gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCATTTCCCCTCTGT,  downstream forward: _UP4_CAAAACATGAAAAGAGGAAA
BKK32870 ([gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32870 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCATTTCCCCTCTGT,  downstream forward: _UP4_CAAAACATGAAAAGAGGAAA
References
19286808

795D70E8A4D750140D6B1AA4BFEBD25C2A389C85

Page visits: 1518

Time of last update: 2021-09-12 06:25:05

Author of last update: Melvin.boenninger