SubtiWiki SubtiWiki
mntB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mntB
168

manganese [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_30760
Molecular weight
27.73 kDa
pI
9.41
Protein length
Gene length
function
manganese uptake
product
manganese [wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
mntB, ytgB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1121

This gene is a member of the following regulons

Gene
Coordinates
3,144,267  3,145,019
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 4-236) (according to UniProt)
Structure
[PDB|2NQ2] (from Haemophilus influenzae, 32% identity) [pubmed|17158291]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|3C40A6E42A669E77ADBF5FFF334061C51F76A4F9|mntA]-[gene|7821C82C6C30079F713B84F1E4D654E07CE5072E|mntB]-[gene|1B7C4AD6CD0632051A0E8CA57034872D13FF67F9|mntC]-[gene|F7DA077FE47DBB409BE2B1D9F12A9D719C246166|mntD]
description
[Pubmed|10760146]
regulation
repressed at high Mn(II) concentrations ([protein|search|MntR]) [Pubmed|12950915]
regulatory mechanism
[protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]: repression, [Pubmed|12950915], in [regulon|protein:FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|mntA]' and '[protein|search|menC]' [PubMed|20525796]
Open in new tab

[gene|3C40A6E42A669E77ADBF5FFF334061C51F76A4F9|mntA]→[gene|F7DA077FE47DBB409BE2B1D9F12A9D719C246166|mntD]

2021-10-21 00:58:57

ghost

8

6e445d5dd4775b53ffb927e076588a54d6db5b65

22EB6DB7C3644A1DB5E7DC4F2D2D0BF8933A5D53

Biological materials
Mutant
MGNA-A286 (ytgB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/286 NBRP B. subtilis, Japan]
BKE30760 ([gene|7821C82C6C30079F713B84F1E4D654E07CE5072E|mntB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GAACATATCCTCCACCTCTT,  downstream forward: _UP4_GAAGGACATAAGGAGTGAGC
BKK30760 ([gene|7821C82C6C30079F713B84F1E4D654E07CE5072E|mntB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GAACATATCCTCCACCTCTT,  downstream forward: _UP4_GAAGGACATAAGGAGTGAGC
labs
[wiki|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
References
10760146,10092453,12950915,10760146,10760146,17158291

7821C82C6C30079F713B84F1E4D654E07CE5072E

Page visits: 1293

Time of last update: 2021-10-19 12:46:04

Author of last update: Melvin.boenninger