SubtiWiki SubtiWiki
ywoF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ywoF
168

unknown

locus
BSU_36460
Molecular weight
51.28 kDa
pI
4.79
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ywoF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,750,768  3,752,174
The protein
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|764E072E7EDA42314D17ECEA2AD983BA95E5ADF9|ywoF]
description
[Pubmed|9353933]
regulation
repressed during logarithmic growth ([protein|search|AbrB]) [Pubmed|18840696]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]: repression, in [regulon|protein:5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh regulon]
Open in new tab

[gene|764E072E7EDA42314D17ECEA2AD983BA95E5ADF9|ywoF]

2021-06-21 13:38:50

ghost

4

e92dc4af706d2bacfd977c9531b0207b8de5e5f4

C0CB5D116E1A7A33897C596D300CE6DABF654116

Biological materials
Mutant
MGNA-A898 (ywoF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/898 NBRP B. subtilis, Japan]
BKE36460 ([gene|764E072E7EDA42314D17ECEA2AD983BA95E5ADF9|ywoF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCGATTCCCATTTCG,  downstream forward: _UP4_TAATTGCTATAAGCGGCGTT
BKK36460 ([gene|764E072E7EDA42314D17ECEA2AD983BA95E5ADF9|ywoF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCGATTCCCATTTCG,  downstream forward: _UP4_TAATTGCTATAAGCGGCGTT
References
18957862,9353933,18840696,220817675

764E072E7EDA42314D17ECEA2AD983BA95E5ADF9

Page visits: 860

Time of last update: 2021-10-19 12:09:17

Author of last update: Bzhu