SubtiWiki SubtiWiki
gmuC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

gmuC
168

glucomannan-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIC of the [category|SW.1.2.2|PTS]

locus
BSU_05830
Molecular weight
48.27 kDa
pI
9.8
Protein length
Gene length
function
glucomannan uptake and phosphorylation
product
glucomannan-specific lichenan-specific [category|SW.1.2.2|PTS], EIIC component
essential
no
synonyms
gmuC, ydhO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1455

This gene is a member of the following regulons

Gene
Coordinates
627,284  628,612
The protein
Protein family
[category|SW.1.2.2|PTS] permease, lactose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIC domain] type-3 (aa 5-411) (according to UniProt)
Structure
[PDB|3QNQ] (EIIC component of diacetylchitobiose specific PTS from ''Bacillus cereus''; 41% identity, 80% similarity) [Pubmed|21471968]
Paralogous protein(s)
[protein|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC], [protein|0650C9EAB395EB6ABDADBE72F0DA9F8E5E606B0E|ywbA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
description
[Pubmed|18177310]
regulation
induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]) [Pubmed|18177310]
regulatory mechanism
[protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]: repression, [Pubmed|18177310], in [regulon|protein:64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|18177310], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|18177310], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]→[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]

2021-10-16 03:26:39

Jstuelk

7

1716709ba10a9af523abc0d89eb44ea784dd12d9

42FBC6CD7712CC913DB98C4B417CB4A13C8FAE20

additional information
[protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Biological materials
Mutant
MGNA-C190 (ydhO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2188 NBRP B. subtilis, Japan]
BKE05830 ([gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GAACACCCTATCCACCCCGA,  downstream forward: _UP4_ATGTGACATAAGGGGAGAGA
BKK05830 ([gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GAACACCCTATCCACCCCGA,  downstream forward: _UP4_ATGTGACATAAGGGGAGAGA
References
18177310,10627040,20817675,21471968

76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC

Page visits: 2124

Time of last update: 2021-10-19 09:53:18

Author of last update: Melvin.boenninger