SubtiWiki SubtiWiki
hemN
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hemN
168

anaerobic coproporphyrinogen III oxidase

locus
BSU_25500
Molecular weight
41.40 kDa
pI
5.53
Protein length
Gene length
function
heme biosynthesis
product
anaerobic coproporphyrinogen III oxidase
essential
no
synonyms
hemN, yqeR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0635

This gene is a member of the following regulons

Gene
Coordinates
2,629,718  2,630,857
The protein
Protein family
anaerobic coproporphyrinogen-III oxidase family (with [protein|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ], according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
SAM (according to UniProt)
Structure
[PDB|1OLT] (from E. coli, 26% identity) [pubmed|14633981]
Paralogous protein(s)
[protein|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ]
Expression and Regulation
Operons
genes
[gene|3744083E3BB30A64D15360A12636665F76C40327|lepA]-[gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]
description
[Pubmed|8757728]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9371469], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
There is a terminator between '[protein|search|lepA]' and '[protein|search|hemN]' with only little readthrough
Open in new tab

[gene|3744083E3BB30A64D15360A12636665F76C40327|lepA]→[gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]

2021-08-12 13:55:39

ghost

7

39ed826203c90d2226c3efa52b0486b18d1b1c11

35FE32B4C189AAA5AF31CBF63C3202958F6B1550

Biological materials
Mutant
BKE25500 ([gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCACCTTCTTTA,  downstream forward: _UP4_TAATTGACATTTTTCTTGTG
BKK25500 ([gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCACCTTCTTTA,  downstream forward: _UP4_TAATTGACATTTTTCTTGTG
References
9371469,8757728,10498703,14633981

757C51296E198849EAC1FFA4D37121D9085930A8

Page visits: 2609

Time of last update: 2021-09-15 09:29:43

Author of last update: Melvin.boenninger