SubtiWiki SubtiWiki
tuaH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

tuaH
168

sugar transferase

locus
BSU_35540
Molecular weight
45.43 kDa
pI
8.03
Protein length
Gene length
function
biosynthesis of teichuronic acid
product
sugar transferase
essential
no
synonyms
tuaH, yvhH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0438

This gene is a member of the following regulons

Gene
Coordinates
3,649,875  3,651,068
The protein
Protein family
[wiki|glycosyltransferase 1 family] (according to UniProt)
Expression and Regulation
Operons
genes
[gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]-[gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]-[gene|54F96DE549F78E6C1580949A21C84B27AF26C4C6|tuaB]-[gene|873EE7A8C9BBFC6E96B0957B450BA665E3C9222D|tuaC]-[gene|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD]-[gene|B89FA71C2924CC0690224AFBFA06DB0FF0D97C0A|tuaE]-[gene|6F0FA23892BB1829174F66C464149DB428A8DE18|tuaF]-[gene|6E4F2BA67FF58085D462F6A6FB6497BDF600FCF6|tuaG]-[gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]
description
[Pubmed|10048024]
regulation
expressed during [wiki|sporulation] in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]) [Pubmed|16497325,15699190]
regulatory mechanism
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|9611818,10627039], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10048024], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]→[gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]

2021-10-20 00:59:55

Jstuelk

8

761c7ee893d8412e202f5ec96ccf574895435d9d

E7C38AD5E6CAA14FB6A6EA9BA986E36B3BBE7E1D

Biological materials
Mutant
BKE35540 ([gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTTCATCACCTTTTCTC,  downstream forward: _UP4_TAGTCCTATAAATTGGGATG
BKK35540 ([gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTTCATCACCTTTTCTC,  downstream forward: _UP4_TAGTCCTATAAATTGGGATG
References
16497325,10048024,9611818,10627039

737B37DA0DA1642AD5C4A824228BFED55FF0652A

Page visits: 1536

Time of last update: 2021-10-20 13:22:27

Author of last update: MBenda