SubtiWiki SubtiWiki
ykrK
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykrK
168

transcription repressor of [gene|search|htpX ]expression

locus
BSU_13480
Molecular weight
26.72 kDa
pI
6.15
Protein length
Gene length
function
regulation of membrane protein quality control
product
transcription repressor of [gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]
essential
no
synonyms
ykrK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,414,125  1,414,826
Expression and Regulation
Operons
genes
[gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]
description
[pubmed|22383849]
Open in new tab

[gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]

2021-08-30 09:20:37

Bzhu

4

ac65c480a2bbe027bc7149a7342273913c87353f

8A4D1A42DA078A34EE648B031A736287443E38A7

Biological materials
Mutant
MGNA-A782 (ykrK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/782 NBRP B. subtilis, Japan]
BKE13480 ([gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCACCTCTTTAAAC,  downstream forward: _UP4_TAGTCTGCGCCACCCCGGCT
BKK13480 ([gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCACCTCTTTAAAC,  downstream forward: _UP4_TAGTCTGCGCCACCCCGGCT
References
22447908,23042994

7283CDE72293A68D0B35E0C028D22FABE7FB43C7

Page visits: 1076

Time of last update: 2021-08-31 21:58:55

Author of last update: Jstuelk