SubtiWiki SubtiWiki
ygzB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ygzB
168

unknown

locus
BSU_08740
Molecular weight
13.05 kDa
pI
9.34
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ygzB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
944,959  945,312
The protein
Protein family
UPF0295 family (single member, according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|7153801F8970FC2F8CC9120474FC04CD9F7C7F78|ygzB]
description
[Pubmed|22383849]
Open in new tab

[gene|7153801F8970FC2F8CC9120474FC04CD9F7C7F78|ygzB]

2021-09-11 22:58:51

Jstuelk

1

3130ae2522d4cff57ae99131935ee744a921f989

8473BA0821C849A0DA6A1D953681CFE7B12852A8

Biological materials
Mutant
BKE08740 ([gene|7153801F8970FC2F8CC9120474FC04CD9F7C7F78|ygzB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCATCCCCCTCTGTT,  downstream forward: _UP4_TAAAATAAGCTGACCGTTTC
BKK08740 ([gene|7153801F8970FC2F8CC9120474FC04CD9F7C7F78|ygzB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08740 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCATCCCCCTCTGTT,  downstream forward: _UP4_TAAAATAAGCTGACCGTTTC

7153801F8970FC2F8CC9120474FC04CD9F7C7F78

Page visits: 791

Time of last update: 2021-08-26 23:53:59

Author of last update: Melvin.boenninger