SubtiWiki SubtiWiki
yezE

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yezE
168

similar to transcriptional regulator ([wiki|TetR family])

locus
BSU_06860
Molecular weight
21.74 kDa
pI
4.89
Protein length
Gene length
function
unknown
product
putative transcriptional regulator ([wiki|TetR family])
essential
no
synonyms
yezE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
753,817  754,401
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 6-66) (according to UniProt)
Structure
[PDB|2I10] (from Rhodococcus sp., 30% identity)
Expression and Regulation
Operons
genes
[gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]
description
[Pubmed|22383849]
Open in new tab

[gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]

2021-10-22 17:11:33

Jstuelk

3

4fd55ea5df2169820cc290cc4ec2a4cc07489cd2

82CCCD9C241B36DE052841E9438E1BAA04F2CC05

Biological materials
Mutant
BKE06860 ([gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAATGATCACCTCCTG,  downstream forward: _UP4_TAACATGTGGTAAAGGATTC
BKK06860 ([gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAATGATCACCTCCTG,  downstream forward: _UP4_TAACATGTGGTAAAGGATTC
References
Reviews
24006471

71344F56CC91C0A62D30C736AF132AA3DAFFCCF2

Page visits: 779

Time of last update: 2021-10-25 23:46:53

Author of last update: Melvin.boenninger