SubtiWiki SubtiWiki
yezE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yezE
168

similar to transcriptional regulator ([wiki|TetR family])

locus
BSU_06860
Molecular weight
21.74 kDa
pI
4.89
Protein length
Gene length
function
unknown
product
putative transcriptional regulator ([wiki|TetR family])
essential
no
synonyms
yezE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309

This gene is a member of the following regulons

Gene
Coordinates
753,817  754,401
The protein
Protein family
[wiki|TetR family]
[wiki|Domains]
[wiki|HTH tetR-type domain] (aa 6-66) (according to UniProt)
Structure
[PDB|2I10] (from Rhodococcus sp., 30% identity)
Expression and Regulation
Operons
genes
[gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]
description
[Pubmed|22383849]
Open in new tab

[gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]

2021-05-13 13:06:20

Jstuelk

1

4fd55ea5df2169820cc290cc4ec2a4cc07489cd2

82CCCD9C241B36DE052841E9438E1BAA04F2CC05

Biological materials
Mutant
BKE06860 ([gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAATGATCACCTCCTG,  downstream forward: _UP4_TAACATGTGGTAAAGGATTC
BKK06860 ([gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAAATGATCACCTCCTG,  downstream forward: _UP4_TAACATGTGGTAAAGGATTC
References
Reviews
24006471

71344F56CC91C0A62D30C736AF132AA3DAFFCCF2

Page visits: 775

Time of last update: 2021-09-08 00:27:16

Author of last update: Melvin.boenninger