SubtiWiki SubtiWiki
yvrHb
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvrHb
168

two-component response regulator ([wiki|OmpR family])

locus
BSU_33221
Molecular weight
27.00 kDa
pI
5.235
Protein length
Gene length
function
regulation cell surface maintenance
product
two-component response regulator ([wiki|OmpR family])
essential
no
synonyms
yvrHb, yvrH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0745

This gene is a member of the following regulons

Gene
Coordinates
3,408,353  3,409,066
Phenotypes of a mutant
unusual autolysis and higher susceptibility to cell envelope antibiotics (bacitracin, aztreonam, cefepime, fosfomycin)  [Pubmed|16306698]
The protein
Catalyzed reaction/ biological activity
transcription activator  [Pubmed|16306698]
Protein family
[wiki|OmpR family] of two-component response regulators
[wiki|Domains]
[wiki|Response regulatory domain] (aa 5-119) (according to UniProt)
Structure
[PDB|2OQR] (from Mycobacterium tuberculosis, 37% identity) [pubmed|17942407]
Modification
phosphorylation (Asp) by [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG]  [Pubmed|16306698]
Effectors of protein activity
phosphorylation likely affects DNA-binding activity
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]-[gene|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG]-[gene|0F65F634368E935585FC015BA64085F3A2244F9B|yvrE]
description
[Pubmed|22383849]
Open in new tab

[gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]→[gene|0F65F634368E935585FC015BA64085F3A2244F9B|yvrE]

2021-08-28 12:40:22

Jstuelk

9

7b1ca7d9926202cb67b2f5ca02dc23abca36fbb6

F9AB94FC785A9E813163AC0107521543FD5405BF

Biological materials
Mutant
MGNA-B050 (yvrH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1049 NBRP B. subtilis, Japan]
BKE33221 ([gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33221 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATGTTCCTTTCTG,  downstream forward: _UP4_CCAAATCCTGAAGGCAAGCG
BKK33221 ([gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33221 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATGTTCCTTTCTG,  downstream forward: _UP4_CCAAATCCTGAAGGCAAGCG
References
10094672,18820022,16306698,17942407

7098319D8E88FDC2A629A3F4A21507FD7A649385

Page visits: 1976

Time of last update: 2021-09-16 05:03:25

Author of last update: Melvin.boenninger