SubtiWiki SubtiWiki
acoR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

acoR
168

transcriptional activator of the [gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|search|acoL ]operon

locus
BSU_08100
Molecular weight
66.98 kDa
pI
7.88
Protein length
Gene length
function
regulation of acetoin utilization
product
transcriptional activator (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]-dependent promoter)
essential
no
synonyms
acoR, yfjG, yzcB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3284

This gene is a member of the following regulons

Gene
Coordinates
883,758  885,575
The protein
Protein family
[wiki|Transcription factors activating transcription at SigL-dependent promoters]
[wiki|Domains]
Sigma-54 factor interaction domain (aa 295-520) (according to UniProt)
Structure
[PDB|5EXX] (from Pseudomonas aeruginosa, C-terminal doamin, corresponds to aa 292 ... 598, 43% identity) [pubmed|26712005]
Expression and Regulation
Operons
genes
[gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]-[gene|4A4A533542E47DE8114B697FADE4CB581E5FB66E|sspH]
description
[Pubmed|11274109]
regulation
repressed by glucose (3.7-fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22900538], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]→[gene|4A4A533542E47DE8114B697FADE4CB581E5FB66E|sspH]

2021-07-21 10:30:30

ghost

4

f16cdf322895e99766a36c4df321103c1bdd5ee5

FD8E94B07C9DDF75DB8610CDEEF8B8C90FF67E80

Biological materials
Mutant
MGNA-C352 (acoR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2350 NBRP B. subtilis, Japan]
1A912 ( ''acoR''::''kan''), [Pubmed|16585774], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A912&Search=1A912 BGSC] and in [wiki|Jörg Stülke]'s lab
BKE08100 ([gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTGATCGCTCCTC,  downstream forward: _UP4_TAAAGCATACTTCCTTCAGG
BKK08100 ([gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTGATCGCTCCTC,  downstream forward: _UP4_TAAAGCATACTTCCTTCAGG
labs
[wiki|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
References
11274109,10368162,22900538,12850135,21906631,26712005

706864AAF36684AD5E46F30E9EB76315AB412700

Page visits: 2280

Time of last update: 2021-09-10 21:18:00

Author of last update: Melvin.boenninger