SubtiWiki SubtiWiki
acoR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

acoR
168

transcriptional activator of the [gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|search|acoL ]operon

locus
BSU_08100
Molecular weight
66.98 kDa
pI
7.88
Protein length
Gene length
function
regulation of acetoin utilization
product
transcriptional activator (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]-dependent promoter)
essential
no
synonyms
acoR, yfjG, yzcB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3284

This gene is a member of the following regulons

Gene
Coordinates
883,758  885,575
The protein
Protein family
[wiki|Transcription factors activating transcription at SigL-dependent promoters]
[wiki|Domains]
Sigma-54 factor interaction domain (aa 295-520) (according to UniProt)
Structure
[PDB|5EXX] (from Pseudomonas aeruginosa, C-terminal doamin, corresponds to aa 292 ... 598, 43% identity) [pubmed|26712005]
Expression and Regulation
Operons
genes
[gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]-[gene|4A4A533542E47DE8114B697FADE4CB581E5FB66E|sspH]
description
[Pubmed|11274109]
regulation
repressed by glucose (3.7-fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22900538], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]→[gene|4A4A533542E47DE8114B697FADE4CB581E5FB66E|sspH]

2021-10-20 02:06:29

ghost

8

f16cdf322895e99766a36c4df321103c1bdd5ee5

FD8E94B07C9DDF75DB8610CDEEF8B8C90FF67E80

Biological materials
Mutant
MGNA-C352 (acoR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2350 NBRP B. subtilis, Japan]
1A912 ( ''acoR''::''kan''), [Pubmed|16585774], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A912&Search=1A912 BGSC] and in [wiki|Jörg Stülke]'s lab
BKE08100 ([gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTGATCGCTCCTC,  downstream forward: _UP4_TAAAGCATACTTCCTTCAGG
BKK08100 ([gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTGATCGCTCCTC,  downstream forward: _UP4_TAAAGCATACTTCCTTCAGG
labs
[wiki|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
References
11274109,10368162,22900538,12850135,21906631,26712005

706864AAF36684AD5E46F30E9EB76315AB412700

Page visits: 2330

Time of last update: 2021-12-04 09:12:41

Author of last update: Melvin.boenninger