SubtiWiki SubtiWiki
ldt

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ldt
168

L,D-transpeptidase involved in cell wall synthesis

locus
BSU_14040
Molecular weight
17.59 kDa
pI
10.25
Protein length
Gene length
function
cell wall biosynthesis
product
L,D-transpeptidase
essential
no
synonyms
ldt, ykuD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1388

This gene is a member of the following regulons

Gene
Coordinates
1,476,518  1,477,012
The protein
Protein family
YkuD family (with [protein|456AF184261976FAA73359E81443F7035F457D07|yciB] and [protein|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB], according to UniProt)
[wiki|Domains]
contains a N-terminal N-acetylglucosamine-polymer-binding [wiki|LysM domain] [Pubmed|18430080]
[wiki|LysM domain] (aa 2-45) (according to UniProt)
Structure
[PDB|1Y7M] [Pubmed|16287140]
[PDB|2MTZ] (complex with a peptidoglycan hexamuropeptide) [Pubmed|25429710]
Paralogous protein(s)
[protein|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB]
[wiki|Localization]
spore wall (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]
description
[Pubmed|11011148]
regulation
expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|11011148], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]

2021-10-16 16:33:45

ghost

4

b45eb98f9bf48c0ce86be9078f99910a86b728e0

135B2E0D94104844F0BA2B2EE17FDDD19CA36C91

genes
[gene|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|ykuE]-[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]-[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]
description
[Pubmed|22383849]
regulation
expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
Open in new tab

[gene|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|ykuE]→[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]

2021-11-02 03:42:40

ghost

10

900f4f5bf9b6f18854e49d4fcb50b165e30a6ce2

AB2193A8638597380A2AEFF9607482D0824BD9F0

Biological materials
Mutant
MGNA-A766 (ykuD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/766 NBRP B. subtilis, Japan]
BKE14040 ([gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGTTTCCTCATCCTCCTTT,  downstream forward: _UP4_TAATGTTTTCTTATTTGTTT
BKK14040 ([gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGTTTCCTCATCCTCCTTT,  downstream forward: _UP4_TAATGTTTTCTTATTTGTTT
References
Reviews
18430080
Original Publications
12850135,11011148,17311917,22383849,22278298,22579252,16287140,25429710

6F256986E591DB82974A7F54EB1CE0C024A6F63B

Page visits: 1544

Time of last update: 2021-11-24 14:58:04

Author of last update: Melvin.boenninger