SubtiWiki SubtiWiki
ldt
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ldt
168

L,D-transpeptidase involved in cell wall synthesis

locus
BSU_14040
Molecular weight
17.59 kDa
pI
10.25
Protein length
Gene length
function
cell wall biosynthesis
product
L,D-transpeptidase
essential
no
synonyms
ldt, ykuD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1388

This gene is a member of the following regulons

Gene
Coordinates
1,476,518  1,477,012
The protein
Protein family
YkuD family (with [protein|456AF184261976FAA73359E81443F7035F457D07|yciB] and [protein|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB], according to UniProt)
[wiki|Domains]
contains a N-terminal N-acetylglucosamine-polymer-binding [wiki|LysM domain] [Pubmed|18430080]
[wiki|LysM domain] (aa 2-45) (according to UniProt)
Structure
[PDB|1Y7M] [Pubmed|16287140]
[PDB|2MTZ] (complex with a peptidoglycan hexamuropeptide) [Pubmed|25429710]
Paralogous protein(s)
[protein|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB]
[wiki|Localization]
spore wall (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]
description
[Pubmed|11011148]
regulation
expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|11011148], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]

2020-11-06 12:56:32

ghost

0

b45eb98f9bf48c0ce86be9078f99910a86b728e0

135B2E0D94104844F0BA2B2EE17FDDD19CA36C91

genes
[gene|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|ykuE]-[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]-[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]
description
[Pubmed|22383849]
regulation
expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
Open in new tab

[gene|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|ykuE]→[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]

2021-07-20 21:55:32

ghost

1

900f4f5bf9b6f18854e49d4fcb50b165e30a6ce2

AB2193A8638597380A2AEFF9607482D0824BD9F0

Biological materials
Mutant
MGNA-A766 (ykuD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/766 NBRP B. subtilis, Japan]
BKE14040 ([gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGTTTCCTCATCCTCCTTT,  downstream forward: _UP4_TAATGTTTTCTTATTTGTTT
BKK14040 ([gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGTTTCCTCATCCTCCTTT,  downstream forward: _UP4_TAATGTTTTCTTATTTGTTT
References
Reviews
18430080
Original Publications
12850135,11011148,17311917,22383849,22278298,22579252,16287140,25429710

6F256986E591DB82974A7F54EB1CE0C024A6F63B

Page visits: 1521

Time of last update: 2021-08-23 07:58:27

Author of last update: Melvin.boenninger