SubtiWiki SubtiWiki
epsI
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

epsI
168

glycosyltransferase, synthesis of extracellular poly-N-acetylglucosamine

locus
BSU_34290
Molecular weight
41.35 kDa
pI
8.04
Protein length
Gene length
function
synthesis of extracellular poly-N-acetylglucosamine
product
glycosyltransferase
essential
no
synonyms
epsI, yveS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5039

This gene is a member of the following regulons

Gene
Coordinates
3,520,030  3,521,106
The EAR [wiki|RNA switch]
20374491,20230605
The protein
Protein family
polysaccharide pyruvyl transferase family (with [protein|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO] and [protein|9A223AE85131511B7EA3A71EA57D87E8B167FA67|yxaB], according to UniProt)
Paralogous protein(s)
[protein|9A223AE85131511B7EA3A71EA57D87E8B167FA67|yxaB]
Expression and Regulation
Operons
genes
[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
description
[Pubmed|15661000]
regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab

[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]→[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]

2021-08-26 05:56:56

ghost

9

972f8e32dbf02ccc05ec1b86b52f3e7c715bf4da

DAC70A15EA1F43CB18727990D26DF72F59759165

Biological materials
Mutant
MGNA-B612 (yveS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1611 NBRP B. subtilis, Japan]
BKE34290 ([gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCCTCTGTTT,  downstream forward: _UP4_CAATGATCCCGCTCGTCAGC
BKK34290 ([gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTCACCCTCTGTTT,  downstream forward: _UP4_CAATGATCCCGCTCGTCAGC
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
References
Reviews
20735481

6EBD8F7065B6C1996067F3120DD9CFEA91D3A444

Page visits: 1587

Time of last update: 2021-09-15 00:02:51

Author of last update: Melvin.boenninger