SubtiWiki SubtiWiki
ppiB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ppiB
168

peptidyl-prolyl isomerase

locus
BSU_23360
Molecular weight
15.11 kDa
pI
5.47
Protein length
Gene length
function
protein folding
product
peptidyl-prolyl isomerase
essential
no
ec
5.2.1.8
synonyms
ppiB, cypBS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0652

This gene is a member of the following regulons

Gene
Coordinates
2,435,360  2,435,791
The protein
Catalyzed reaction/ biological activity
[protein]-peptidylproline (ω=180) --> [protein]-peptidylproline (ω=0) (according to UniProt)
Protein family
cyclophilin-type PPIase family (single member, according to UniProt)
[wiki|Domains]
PPIase cyclophilin-type domain (aa 1-143) (according to UniProt)
Structure
[PDB|2MVZ] (from Geobacillus kaustophilus, 75% identity) [pubmed|25923019]
Expression and Regulation
Operons
genes
[gene|6D38B333DE44EB903E151004BA30F3361CC1BE7C|ppiB]
description
[Pubmed|8022278]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8022278], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6D38B333DE44EB903E151004BA30F3361CC1BE7C|ppiB]

2020-11-06 12:56:32

ghost

0

6bc70114a0409ba51a640cea5c51d767265c9112

A141CFD5577DBDCFD0AA18FFF7B496AF056FF17C

Biological materials
Mutant
BKE23360 ([gene|6D38B333DE44EB903E151004BA30F3361CC1BE7C|ppiB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGTATGCCTACTTTCT,  downstream forward: _UP4_TAATCGGCAGGCAAAAGGCT
BKK23360 ([gene|6D38B333DE44EB903E151004BA30F3361CC1BE7C|ppiB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTGTATGCCTACTTTCT,  downstream forward: _UP4_TAATCGGCAGGCAAAAGGCT
References
9748346,1516692,9297832,8639516,8022278,25923019

6D38B333DE44EB903E151004BA30F3361CC1BE7C

Page visits: 1857

Time of last update: 2021-09-14 15:29:01

Author of last update: Melvin.boenninger