SubtiWiki SubtiWiki
sspP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sspP
168

probable small acid-soluble spore protein (minor)

locus
BSU_17980
Molecular weight
5.30 kDa
pI
10.99
Protein length
Gene length
function
protection of spore DNA
product
probable small acid-soluble spore protein (minor)
essential
no
synonyms
sspP, cotL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5861

This gene is a member of the following regulons

Gene
Coordinates
1,926,128  1,926,274
The protein
Protein family
sspP family (single member, according to UniProt)
[wiki|Localization]
spore core (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|174047392BCCE4D57528ED78866626252BBF10D2|sspO]-[gene|6C0BA5B55EE5CF737C4E263BFFF760374054C6AE|sspP]
description
[Pubmed|10806362]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|10806362]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|10806362], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|174047392BCCE4D57528ED78866626252BBF10D2|sspO]→[gene|6C0BA5B55EE5CF737C4E263BFFF760374054C6AE|sspP]

2021-08-04 16:33:18

ghost

3

9afd3a72c2e33c0f42a11caea9ee31e623183715

263B586BE30D228063DC840EDC6C014469AB25A4

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE17980 ([gene|6C0BA5B55EE5CF737C4E263BFFF760374054C6AE|sspP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAATGAGAACCTCCTT,  downstream forward: _UP4_TAAGAAAAGCAGACCTTAGT
BKK17980 ([gene|6C0BA5B55EE5CF737C4E263BFFF760374054C6AE|sspP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17980 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAATGAGAACCTCCTT,  downstream forward: _UP4_TAAGAAAAGCAGACCTTAGT
References
10806362,30782632

6C0BA5B55EE5CF737C4E263BFFF760374054C6AE

Page visits: 887

Time of last update: 2021-08-30 09:33:15

Author of last update: Melvin.boenninger