SubtiWiki SubtiWiki
znuC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

znuC
168

high-affinity [wiki|ABC transporter] for zinc (ATP-binding protein)

locus
BSU_02860
Molecular weight
26.17 kDa
pI
8.2
Protein length
Gene length
function
zinc uptake
product
[wiki|ABC transporter] for zinc (ATP-binding protein)
essential
no
ec
3.6.3.-
synonyms
znuC, ycdI, adcC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1121

This gene is a member of the following regulons

Gene
Coordinates
309,347  310,042
Phenotypes of a mutant
reduced genetic competence, can be rescued by the addition of excess zinc [Pubmed|21813502]
reduced expression of the ''[gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]'' operon  [Pubmed|21813502]
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 4-230) (according to UniProt)
Structure
[PDB|4YMS] (from ''Caldanaerobacter subterraneus'', 31% identity) [Pubmed|25848002]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]-[gene|6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3|znuC]-[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB]
description
[Pubmed|9811636]
regulation
induced by zinc starvation ([protein|search|Zur]) [Pubmed|12426338]
regulatory mechanism
[protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|protein:A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12426338], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]→[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB]

2021-09-18 05:52:37

ghost

7

d84622c86cda894bc37d4650ce0ef2c146681ec6

DA65C8A158A0243655AECDC10E982F7866F2A4D9

Biological materials
Mutant
MGNA-B981 (ycdI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1980 NBRP B. subtilis, Japan]
BKE02860 ([gene|6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3|znuC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTAATCTTCCTTTCTC,  downstream forward: _UP4_GGATGGAAATGTTTGACTTG
BKK02860 ([gene|6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3|znuC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTAATCTTCCTTTCTC,  downstream forward: _UP4_GGATGGAAATGTTTGACTTG
References
12426338,9811636,10092453,21813502,12426338,25848002,27561249

6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3

Page visits: 1588

Time of last update: 2021-09-18 20:51:25

Author of last update: Melvin.boenninger