SubtiWiki SubtiWiki
cheA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cheA
168

two-component sensor kinase, chemotactic signal modulator

locus
BSU_16430
Molecular weight
74.59 kDa
pI
4.45
Protein length
Gene length
function
chemotactic signal modulator
product
two-component sensor kinase
essential
no
synonyms
cheA, cheN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0643

This gene is a member of the following regulons

Gene
Coordinates
1,712,815  1,714,833
Phenotypes of a mutant
not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY] and [protein|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB] [Pubmed|11553614]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
HPt domain (aa 1-103) (according to UniProt)
[wiki|Histidine kinase domain] (aa 290-540) (according to UniProt)
CheW-like domain (aa 542-672) (according to UniProt)
Structure
[PDB|6S1K] (from E. coli, 35% identity) [pubmed|31925330]
Modification
autophosphorylation on a His residue
Effectors of protein activity
phosphorylation of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA] is stimulated by interaction with the complex of deaminated [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|mcpC]-[protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD] [Pubmed|22931217]
the kinase activity of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA] is activated by chemoreceptors bound to [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD] [Pubmed|23226535]
[wiki|Localization]
membrane (according to UniProt)
localizes to the cell poles [Pubmed|21098025]
Expression and Regulation
Operons
genes
[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
description
[Pubmed|20233303]
regulation
see [wiki|fla-che operon]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]: activation, in [regulon|protein:5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9657996], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|20233303], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]→[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]

2021-07-24 23:35:33

Jstuelk

18

EECFE9022742ECC57D9BBA5CE7DB7A4D1BFD42A8

0535E3D13CBD000A94D62050515BF8D1D5E3F011

genes
[gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]-[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]-[gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]-[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]-[gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]-[gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]-[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]-[gene|600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC|fliJ]-[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
description
[Pubmed|9657996,8157612,15175317]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]: activation, in [regulon|protein:5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9657996], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|9657996], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]→[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]

2021-09-15 12:46:52

Jstuelk

17

024d59ae468aa14568753f57122b789c39ed6c06

4D920B925DA071AE7390E022B9AB625E40B7B2AC

additional information
in minimal medium, CheA is present with 2,600 +/- 560 molecules per cell [PubMed|21515776]
Biological materials
Mutant
1A797 ( ''cheA''::''cat''), [Pubmed|1938941], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A797&Search=1A797 BGSC]
DS6887 (marker-less in NCIB3610) [Pubmed|25313396]
BKE16430 ([gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACTGATTCATATCCATTT,  downstream forward: _UP4_TAACCATTCGAGGAGGTGTC
BKK16430 ([gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATACTGATTCATATCCATTT,  downstream forward: _UP4_TAACCATTCGAGGAGGTGTC
labs
[wiki|Daniel Kearns]
References
Reviews
20122866
Original Publications
26122431,25313396,1938941,12123464,17908686,8866475,12094812,10094672,11722727,14651647,9657996,8157612,15175317,9721285,17850253,11553614,21098025,22931217,21515776,23226535,24386445,25039821,31925330

6B3B222E56BF0C95A2371CA5208B5522B44D4689

Page visits: 3808

Time of last update: 2021-09-15 23:54:14

Author of last update: Jstuelk