SubtiWiki SubtiWiki
yqeV
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqeV
168

tRNA methylthiotransferase

locus
BSU_25430
Molecular weight
51.49 kDa
pI
5.24
Protein length
Gene length
function
tRNA maturation
product
tRNA methylthiotransferase
essential
no
synonyms
mtaB, yqeV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0621

This gene is a member of the following regulons

Gene
Coordinates
2,621,677  2,623,032
The protein
Catalyzed reaction/ biological activity
modification of N(6)-threonylcarbamoyladenosine (t(6)A) to 2-methylthio-N(6)-threonylcarbamoyladenosine (ms(2)t(6)A) in tRNA [Pubmed|27913733,20472640]
[sulfur carrier]-SH + AH2 + N6-L-threonylcarbamoyladenosine37 in tRNA + 2 S-adenosyl-L-methionine --> 2-methylsulfanyl-N6-L-threonylcarbamoyladenosine37 in tRNA + 5'-deoxyadenosine + [sulfur carrier]-H + A + 2 H+ + L-methionine + S-adenosyl-L-homocysteine (according to UniProt)
Protein family
methylthiotransferase family (with [protein|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB], according to UniProt)
[wiki|Domains]
MTTase N-terminal domain (aa 2-114) (according to UniProt)
[wiki|TRAM domain] (aa 372-437) (according to UniProt)
[wiki|Cofactors]
2 Fe-S clusters [Pubmed|20584901]
Structure
[PDB|4JC0] (from ''Thermotoga maritima'', 29% identity) [Pubmed|23542644]
Paralogous protein(s)
[protein|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
description
[Pubmed|9023197]
regulation
induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
regulatory mechanism
[protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]: repression, [Pubmed|1339421], in [regulon|protein:2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1339421], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]→[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]

2021-04-11 01:54:54

ghost

2

5537cbdd2a5f5134768e8ba4f02922d86d6e912b

1FEFD4DF6108A61DA84FEA3CD39009FF4CA3EC3B

Biological materials
Mutant
MGNA-C496 (yqeV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2494 NBRP B. subtilis, Japan]
BKE25430 ([gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTATGGAAAGCAACAGTTG,  downstream forward: _UP4_TAACCTAAAAAATCGGTGCA
BKK25430 ([gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGTATGGAAAGCAACAGTTG,  downstream forward: _UP4_TAACCTAAAAAATCGGTGCA
References
10383760,9023197,7592421,20472640,20584901,27913733,23542644

6ADA5AF308D96218414EA92DFF4A57BAEAD0554B

Page visits: 1425

Time of last update: 2021-04-08 13:06:11

Author of last update: Melvin.boenninger